In vitro cross-resistance to doravirine in a panel of HIV-1 clones harbouring a number of NNRTI

attr-meeting

The impact of the presence of kids on grownup smoking behaviour: empirical proof based mostly on China household panel research

Background: Regardless of numerous research linking household and marriage components with well being behaviour, the consequences of kids on the well being behaviour of fogeys are nonetheless understudied. This research explored the affiliation between the presence of kids and adults’ smoking behaviours.

 

StrategiesThis research used panel information from the China Household Panel Research 2010 and 2012, and the info set included 23,157 households and 45,513 adults. Logistic regression was carried out to analyse the affiliation of the presence of kids on adults’ smoking behaviours. Subgroup regression was used to look at heterogeneous results.

 

OutcomesFull pattern regressions confirmed that the variety of kids was considerably inversely related to smoking behaviour (OR = 0.93; 95% 0.90-0.96). Additional subsample regression finds that such impact is barely important among the many high-education group (OR = 0.92; 95% 0.87-0.97), high-skill staff (OR = 0.89; 95% 0.80-0.99) and {couples} who had an age hole higher than 2 years (OR = 0.91; 95% 0.88-0.95).

 

Conclusions: Our findings verify the existence of the upward intergenerational impact of the presence of kids on adults’ smoking behaviour in China. Nonetheless, such results are usually not equal throughout all demographic traits. Future analysis might discover different components of the upward mechanism and potential pathways for a stronger impact. In resource-poor areas, focusing on cessation actions at those that have kids at an early age could also be an efficient technique.

attr-meeting

attr-meeting

NATtrol Flu Verification Panel (7 X 0.5 mL)

NATFVP-NNS 7 X 0.5 mL
EUR 394.24
  • What is the product classification?
  • NATtrol Flu Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Core Panel Multi-Tumor control slides

TS900 Set of 5
EUR 218

Core Panel Multi-Tumor control slides

TS900-25 Set of 25
EUR 485

Breast Panel Multi-Tumor control slides

TS901 Set of 5
EUR 218

Breast Panel Multi-Tumor control slides

TS901-25 Set of 25
EUR 485

Porcine Swine FLU virus A (FLU A) ELISA Kit

QY-E40037 96T
EUR 400

Ivd/ Rat Ivd ELISA Kit

ELI-39421r 96 Tests
EUR 886

Human FLU ELISA Kit

EHF0241 96Tests
EUR 521

Goat FLU ELISA Kit

EGTF0241 96Tests
EUR 521

Canine FLU ELISA Kit

ECF0241 96Tests
EUR 521

Bovine FLU ELISA Kit

EBF0241 96Tests
EUR 521

Anserine FLU ELISA Kit

EAF0241 96Tests
EUR 521

Porcine FLU ELISA Kit

EPF0241 96Tests
EUR 521

Rat FLU ELISA Kit

ERF0241 96Tests
EUR 521

Rabbit FLU ELISA Kit

ERTF0241 96Tests
EUR 521

Mouse FLU ELISA Kit

EMF0241 96Tests
EUR 521

IVD siRNA

20-abx902738
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IVD siRNA

20-abx920988
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IVD siRNA

20-abx920989
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IVD antibody

22140-100ul 100ul
EUR 390

IVD antibody

10R-4491 100 ul
EUR 691
Description: Mouse monoclonal IVD antibody

IVD antibody

70R-18039 50 ul
EUR 435
Description: Rabbit polyclonal IVD antibody

IVD antibody

70R-13603 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal IVD antibody

IVD Antibody

DF12284 200ul
EUR 304
Description: IVD antibody detects endogenous levels of IVD.

IVD Antibody

1-CSB-PA011921GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

IVD Antibody

1-CSB-PA011921LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

anti-IVD

YF-PA12811 50 ug
EUR 363
Description: Mouse polyclonal to IVD

anti-IVD

YF-PA12812 100 ug
EUR 403
Description: Rabbit polyclonal to IVD

Bordetella bronchiseptica proteins (inactivated vaccine for dog) for ELISA

BBV15-N-100 100 ug
EUR 286

Guinea Pig FLU ELISA Kit

EGF0241 96Tests
EUR 521

Human FLU-H5 ELISA Kit

201-12-2128 96 tests
EUR 440
  • This FLU-H5 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

FLU-A DOT-ELISA Kit

DEIA436 6T/30T
EUR 580
Description: This kit is an in vitro immunoassay test (Dot-ELISA) for the direct, rapid and qualitative detection of nucleoprotein (NP) antigen of Influenza A Virus in human nasopharyngeal aspirates, swabs, nasal wash, chicken embryo whole virus inoculation or viral lysates, etc. It is intended for clinical identification influenza type-A viruses.

Human FLU-H5 ELISA Kit

QY-E04880 96T
EUR 361

IVD cloning plasmid

CSB-CL011921HU-10ug 10ug
EUR 465
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1272
  • Sequence: atggcgactgcgactcggctgctggggtgtcgtgtggcgagctggaggctgcggccgccgcttgccggcttcgtttcccagcgggcccactcgcttttgcccgtggacgatgcaatcaatgggctaagcgaggagcagaggcagcttcgtcagaccatggctaagttccttcagg
  • Show more
Description: A cloning plasmid for the IVD gene.

anti- IVD antibody

FNab04426 100µg
EUR 505.25
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

anti- IVD antibody

FNab04427 100µg
EUR 585
  • Recommended dilution: WB: 1:1000-1:6000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

IVD Rabbit pAb

A15281-100ul 100 ul
EUR 308

IVD Rabbit pAb

A15281-200ul 200 ul
EUR 459

IVD Rabbit pAb

A15281-20ul 20 ul
EUR 183

IVD Rabbit pAb

A15281-50ul 50 ul
EUR 223

Human IVD Antibody

33170-05111 150 ug
EUR 261

IVD Polyclonal Antibody

28898-100ul 100ul
EUR 252

IVD Polyclonal Antibody

28898-50ul 50ul
EUR 187

IVD Blocking Peptide

DF12284-BP 1mg
EUR 195

Anti-IVD antibody

PAab04426 100 ug
EUR 355

Anti-IVD antibody

STJ117476 100 µl
EUR 277
Description: Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

IVD, Human Recombinant

P1577-100 100 µg
EUR 510

IVD, Human Recombinant

P1577-20 20 µg
EUR 156

Saponin Vaccine Adjuvant

VAdv-Ly0009 1 g
EUR 1095
Description: Saponin Vaccine Adjuvant, plant-based vaccine adjuvant.

Recombinant flagellin FlicC vaccine adjuvant (TLR5 agonist); vaccine adjuvant

AV-7010-50 50 ug
EUR 895

ELISA kit for Human PLA2G4D (Phospholipase A2, Group IVD)

ELK6188 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phospholipase A2, Group IVD (PLA2G4D). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Phospholipase A2, Group IVD from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Goat IgG (-ve control for flow cytometry) (isotype control)

20011-100 100 test
EUR 103

IVD Polyclonal Conjugated Antibody

C28898 100ul
EUR 397

Mouse IVD shRNA Plasmid

20-abx974716
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat IVD shRNA Plasmid

20-abx984521
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human IVD ELISA KIT

ELI-12848h 96 Tests
EUR 824

Bovine IVD ELISA KIT

ELI-13527b 96 Tests
EUR 928

IVD ELISA KIT|Human

EF010406 96 Tests
EUR 689

Mouse Ivd ELISA KIT

ELI-43520m 96 Tests
EUR 865

IVD protein (His tag)

80R-1262 100 ug
EUR 268
Description: Purified recombinant Human IVD protein

Human IVD shRNA Plasmid

20-abx952499
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IVD Antibody, HRP conjugated

1-CSB-PA011921LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IVD Antibody, FITC conjugated

1-CSB-PA011921LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IVD Antibody, Biotin conjugated

1-CSB-PA011921LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

IVD Recombinant Protein (Human)

RP016447 100 ug Ask for price

IVD Recombinant Protein (Rat)

RP206471 100 ug Ask for price

IVD Recombinant Protein (Mouse)

RP144596 100 ug Ask for price

BSA Control for AGE-BSA

35R-AA007 10 mg
EUR 224
Description: BSA Control for AGE protein (BSA modified), Cat No. 30R-AA007

BSA Control for Age-BSA

2221-BSA
EUR 175

Calcium phosphate vaccine adjuvant

AV-1020-100 100 ml
EUR 219

Peanut Oil vaccine adjuvant

AV-5010-50 50 ml
EUR 225

Mineral Oil vaccine adjuvant

AV-5020-50 50 ml
EUR 225

Mannide monooleate vaccine adjuvant

AV-5030-5 5 g
EUR 164

HS15 Kolliphore vaccine adjuvant

AV-6010-100 100 g
EUR 286

Pam2CSK4 vaccine adjuvant, unlabeled

AV-9020-1 1 mg
EUR 408

Pam3CSK4 vaccine adjuvant, unlabeled

AV-9025-1 1 mg
EUR 286

Mouse Monoclonal Anti-Gardasil vaccine L1s (Human Papilloma Virus/HPV6+11+16+18 late proteins) antiserum control for ELISA

HPV618L13-S 1 ml
EUR 469

Human Influenza viruses IgG(FLU)ELISA Kit

GA-E1783HM-48T 48T
EUR 289

Human Influenza viruses IgG(FLU)ELISA Kit

GA-E1783HM-96T 96T
EUR 466

Pig Swine Influenza Virus (FLU) ELISA Kit

abx157184-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.

Human Influenza viruses IgG,FLU ELISA Kit

201-12-1767 96 tests
EUR 440
  • This Influenza viruses IgG ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Influenza viruses IgG(FLU)ELISA Kit

QY-E02255 96T
EUR 361

Paraffin Tissue Section Panel - Mouse Whole Brain Segmentation Panel

T8334035 5 slides
EUR 556
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Frozen Tissue Section Panel - Mouse Whole Brain Segmentation Panel

T6334035 5 slides
EUR 931
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Rabbit Anti-West Nile Virus vaccine (WNV, Recombitek/DNA vaccine) antiserum

WNV13-S 100 ul
EUR 457

Control for HER2, 4 cases (1.5mm)

HRC081 1
EUR 85
Description: IHC control array containing 4 breast cancer cases of strong, moderate, low and negative HER2 breast cancer expressers in duplicates

Control for ER, 4 cases (1.5mm)

ERC081 1
EUR 85
Description: IHC control array containing 4 breast cancer cases of strong, moderate, weak/nil estrogen receptor (ER) expressers in duplicates

SLLK, Control Peptide for TSP1 Inhibitor

HY-P0301 1mg
EUR 133

Control for DOG1, 3 cases (1.5mm)

DOG1061 1
EUR 85
Description: IHC control array containing 3 GIST cases of strong, moderate, weak/nil DOG1 expressers in duplicates

Control for Ckit, 6 samples (1.5mm)

CKIT061 1
EUR 85
Description: Gastrointestinal stroma tumors, 6 cores, 3 cases in duplicates showing strong, moderate and no expression of cKit molecule.

Control for PR, 3 cases (1.5mm)

PRC061 1
EUR 85
Description: IHC control array containing 3 breast cancer cases of strong, moderate, low/negative progesterone receptor (PR) expressers in duplicates

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-100 100 Slides
EUR 706

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-25 25 Slides
EUR 232

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-5 5 Slides
EUR 98

Thiostatin Rat protein, control for western

TSTN11-C 100 ul
EUR 286

Control/Blocking peptide for Human WNT5a

WNT511-P 100 ug
EUR 164

Human IVD Antibody (Biotin Conjugate)

33170-05121 150 ug
EUR 369

IVD ORF Vector (Human) (pORF)

ORF005483 1.0 ug DNA
EUR 95

Ivd ORF Vector (Rat) (pORF)

ORF068825 1.0 ug DNA
EUR 506

Ivd ORF Vector (Mouse) (pORF)

ORF048200 1.0 ug DNA
EUR 506

Peptidoglycan (S. aureus); vaccine adjuvant

AV-7045-25 25 mg
EUR 1017

Peptidoglycan (S. aureus); vaccine adjuvant

AV-7045-5 5 mg
EUR 286

RWJ 21757 Synthetic vaccine adjuvant

AV-9010-1 1 mg
EUR 164

RWJ 21757 Synthetic vaccine adjuvant

AV-9010-5 5 mg
EUR 286

Pam2CSK4 vaccine adjuvant; Biotin conjugate

AV-9020-B 1 mg
EUR 408

Pam2CSK4 vaccine adjuvant; Biotin conjugate

AV-9020-B-100 100 ug
EUR 164

Pam3CSK4 vaccine adjuvant; Biotin labelled

AV-9025-B 100 ug
EUR 347

Pam3CSK4 vaccine adjuvant; FITC labelled

AV-9025-F 100 ug
EUR 347

Pertussis Toxin B.Pertussis, vaccine grade

AV-9130-50 50 ug
EUR 529

Human Influenza viruses A(FLU A)ELISA Kit

GA-E1612HM-48T 48T
EUR 289

Human Influenza viruses A(FLU A)ELISA Kit

GA-E1612HM-96T 96T
EUR 466

Human Influenza viruses A,FLU A ELISA Kit

201-12-1596 96 tests
EUR 440
  • This Influenza viruses A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Influenza viruses B,FLU B ELISA Kit

201-12-2058 96 tests
EUR 440
  • This Influenza viruses B ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Influenza viruses B(FLU B)ELISA Kit

QY-E02256 96T
EUR 361

Human Influenza viruses A(FLU A)ELISA Kit

QY-E02257 96T
EUR 361

Ferret IgG (Control, non-immune, isotype control), semi-pure for ELISA

20021-1 100 ug
EUR 225

Elk IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20024-1 100 ug
EUR 225

Deer IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20024-2 100 ug
EUR 225

Bison IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20025-1 100 ug
EUR 225

Raccoon IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20026-1 100 ug
EUR 225

Skunk IgG, semi-pure for ELISA (Control, non-immune, isotype control)

20027-1 100 ug
EUR 225

Rabbit Anti-Gardasil vaccine (merck) antiserum (Human Papilloma Virus 16+18 (HPV16/18) late proteins L1 (HPV16+18L1) control for ELISA

HPV16181-S 500 ul
EUR 469

Multiplex ELISA Kit For Human Cytokine Panel 1 (6-Plex)

MEK1010 1 kit
EUR 1084

Multiplex ELISA Kit For Mouse Cytokine Panel 1 (6-Plex)

MEK1011 1 kit
EUR 1084

Multiplex ELISA Kit For Human Cytokine Panel 2 (6-Plex)

MEK1012 1 kit
EUR 1084

Multiplex ELISA Kit For Mouse Cytokine Panel 2 (6-Plex)

MEK1013 1 kit
EUR 1084

Multiplex ELISA Kit For Mouse Cytokine Panel 1 (4-Plex)

MEK1015 1 kit
EUR 879

Multiplex ELISA Kit For Mouse Cytokine Panel 2 (4-Plex)

MEK1016 1 kit
EUR 879

Holder for Plasmid Midi, Maxi and Maxi plus, Ion Exchange column

FAPDE-holder-for-ion-exchange 1 prep
EUR 158

Human Anti-Merozoite surface protein-1 (MSP-1; P. falciparum/malaria vaccine) IgG antiserum negative control

970-360-01N 1 ml
EUR 164

Human Anti-Merozoite surface protein-1 (MSP-1; P. falciparum/malaria vaccine) IgG antiserum positive control

970-360-02P 1 ml
EUR 225

Human Anti-Merozoite surface protein-1 (MSP-1; P. falciparum/malaria vaccine) IgM antiserum negative control

970-370-01N 1 ml
EUR 164

Human Anti-Merozoite surface protein-1 (MSP-1; P. falciparum/malaria vaccine) IgM antiserum positive control

970-370-02P 1 ml
EUR 225

Human Apolipoprotein B protein control for WB

APOB21-C 100 ul
EUR 286

Rec. Human CD21 protein control for WB

CD21-C 100 ul
EUR 286

Bovine Adenosine deaminase protein control for Western

ADA11-C 100 ul
EUR 286

Haptoglobin Human Plasma protein control for WB

HGLB18-C 100 ul
EUR 286

Human Hemopexin purified protein control for Western

HPEX11-C 100 ul
EUR 286

Hemopexin Mouse, purified protein control for Western

HPEX16-C 100 ul
EUR 286

Purified Flagellin (salmonella) protein control for WB

FLGN17-C 100 ul
EUR 286

SLLK, Control Peptide for TSP1 Inhibitor(TFA)

HY-P0301A 5mg
EUR 380

Mouse IgG (-ve control for flow cytometry)

20008-1-100 100 tests
EUR 103

Rabbit IgG (-ve control for flow cytometry)

20009-1-100 100 tests
EUR 103

Mouse Ceruloplasmin protein control for western blot

CP16-C 100 ul
EUR 286

Rat Ceruloplasmin protein control for western blot

CP17-C 100 ul
EUR 286

Control/Blocking peptide for Ephrin-B2 antibody

NIVE2B-C 100 ug
EUR 164

Mouse negative control sera (purified) for IHC

NCM802M 7 ml
EUR 199

Positive Control for Anti-Human CYP1A2 Antibody

P1A2CON 100 uL
EUR 125

Control Sections for FD NeuroSilver™ Kit

PCS101 each
EUR 53.83
Description: Best quality products

Positive Control for Anti-Human CYP1B1 Antibody

PH1B1CON 100 uL
EUR 125

Positive Control for Anti-Rat MEH Antibody

MEHCON 100 uL
EUR 125

Purified bovine Lactoferrin protein control for Western

LTF13-C 100 ul
EUR 286

Chicken Egg Ovalbumin protein control for Western

OVA11-C 100 ul
EUR 286

Positive Control for Anti-Rat CYP2B1 Antibody

P2B1PTCON 100 uL
EUR 125

Positive Control for Anti-Rat CYP2C Antibody

P2CCON 100 uL
EUR 125

Positive Control for Anti-Rat CYP2D Antibody

P2DCON 100 uL
EUR 125

Positive Control for Anti-Human CYP2E1 Antibody

P2E1PTCON 100 uL
EUR 125

Positive Control for Anti-Rat CYP3A2 Antibody

P3A2PTCON 100 uL
EUR 125

Positive Control for Anti-Human CYP3A Antibody

P3ACON 100 uL
EUR 125

Purified, Bovine S100 protein control for WB

S1001-C 100 ul
EUR 286

Purified, Human S100 protein control for WB

S1002-C 100 ul
EUR 286

Control/Blocking peptide for Mouse Vimentin (Vim)

VIM11-C 100 ug
EUR 164

Control/Blocking peptide for Human WNT-1

WNT111-P 100 ug
EUR 457

Isovaleryl Coenzyme A Dehydrogenase (IVD) Antibody

20-abx113287
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phospholipase A2, Group Ivd (Cytosolic) Antibody

20-abx114481
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

In vitro cross-resistance to doravirine in a panel of HIV-1 clones harbouring a number of NNRTI resistance mutations

AimsDoravirine is a not too long ago licensed HIV-1 NNRTI with improved efficacy, pharmacokinetics and security profile in contrast with efavirenz and restricted cross-resistance with rilpivirine and etravirine. On this in vitro research, cross-resistance to doravirine was analysed in a consultant panel of NNRTI-resistant clones.

 

StrategiesIn vitro phenotypic susceptibility to doravirine was assessed in 10 clinically derived infectious clones with intermediate- to high-level resistance to rilpivirine, etravirine, efavirenz and nevirapine, and in NL4-Three site-directed mutants harbouring Ok103N, Y181C, M230L or Ok103N/Y181C NNRTI mutations

 

OutcomesThough not one of the infectious clones harboured any of the foremost doravirine resistance-associated mutations (RAMs) included within the IAS-USA reference record, doravirine fold change (FC) values had been akin to or larger than these calculated for different NNRTIs, notably etravirine and rilpivirine.

 

As anticipated, single NNRTI mutations Ok103N and Y181C didn’t impair doravirine susceptibility (FC 1.Four and 1.8, respectively), whereas lowered exercise was noticed with the only M230L or double Ok103N/Y181C mutations (FC 7.6 and 4.9, respectively). Median FC values elevated considerably with growing numbers of NNRTI RAMs (P = 0.005) and had been >10 in 4/Four and 1/Four clones harbouring 4 and three NNRTI RAMs, respectively. FC values correlated effectively with predicted susceptibility as inferred by Stanford HIV Drug Resistance Database (HIVdb) and ANRS algorithms (each P < 0.001).

 

Conclusions: Substantial cross-resistance to doravirine was detected in NNRTI-resistant viruses harbouring advanced mutational patterns, even within the absence of main IAS-USA doravirine RAMs. Due to this fact, based mostly on the straightforward IAS-USA reference record, doravirine resistance could also be underestimated in viruses harbouring a number of NNRTI mutations.

Affiliation between modifications in financial exercise and catastrophic well being expenditure: findings from the Korea Well being Panel Survey, 2014-2016

 

Background: The speed of catastrophic well being expenditure (CHE) continues to rise in South Korea. This research examined the affiliation between modifications in financial exercise and CHE experiences in South Korea.

 

StrategiesThis research analyzed the Korea Well being Panel Survey information utilizing a logistic regression evaluation to review the affiliation between modifications in financial exercise in 2014-2015 and the members‘ CHE experiences in 2015. The research included a complete of 12,454 people over the age of 19. The subgroup analyses had been organized by intercourse, age, health-related variables, and family stage variables, and the explanations for leaving financial exercise.

 

OutcomesThose that give up financial actions had been extra more likely to expertise CHE than those that continued to have interaction in financial actions (OR [odds ratio] = 2.10; 95% CI [confidence interval]: 1.31-3.36). The subgroup evaluation outcomes, in line with health-related variables, confirmed that there’s a tendency to a better Charlson comorbidity index, a better OR, and, in teams that give up their financial actions, folks with disabilities had been extra more likely to expertise CHE than folks with out disabilities (OR = 5.63; 95% CI 1.71-18.59, OR = 1.82; 95% CI 1.08-3.08, respectively).

 

One other subgroup evaluation discovered that if the rationale for not taking part in financial exercise was a health-related subject, the participant was extra more likely to expertise CHE (energetic → inactive: OR = 2.40; 95% CI 0.61-9.43, inactive → inactive OR = 1.65; 95% CI 1.01-2.68).

 

 

Conclusions: These people who grew to become unemployed had been extra more likely to expertise CHE, particularly if well being issues precipitated the job loss. Due to this fact, efforts are wanted to increase protection for these individuals who endure from excessive medical bills.

Positive control tissue section for each antibody; Based on availability INQUIRE

Control-Slides Set of 5
EUR 176

SeroDetect HIV-Ab Verification Panel (5 X 1.5 mL)

KZMC006 5 X 1.5 mL
EUR 278.8
  • What is the product classification?
  • SeroDetect HIV-Ab Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect Anti-HBs Verification Panel (6 X 1.5 mL)

KZMC008 6 X 1.5 mL
EUR 278.8
  • What is the product classification?
  • SeroDetect Anti-HBs Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect Anti-HBcore Verification Panel (5 X 1.5 mL)

KZMC009 5 X 1.5 mL
EUR 278.8
  • What is the product classification?
  • SeroDetect Anti-HBcore Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect Anti-HCV Verification Panel (5 X 1.5 mL)

KZMC010 5 X 1.5 mL
EUR 278.8
  • What is the product classification?
  • SeroDetect Anti-HCV Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect HTLV Ab Verification Panel (5 X 1.5 mL)

KZMC011 5 X 1.5 mL
EUR 278.8
  • What is the product classification?
  • SeroDetect HTLV Ab Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect Dengue Fever Verification Panel (10 X 0.5 mL)

KZMC028 10 X 0.5 mL
EUR 272.56
  • What is the product classification?
  • SeroDetect Dengue Fever Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect HIV-Ab Range Verification Panel (10 X 1.5 mL)

KZMC024 10 X 1.5 mL
EUR 278.8
  • What is the product classification?
  • SeroDetect HIV-Ab Range Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect West Nile Virus Verification Panel (10 X 0.5 mL)

KZMC027 10 X 0.5 mL
EUR 278.8
  • What is the product classification?
  • SeroDetect West Nile Virus Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Core Panel Multi-Tumor control slides

TS900 Set of 5
EUR 218

Core Panel Multi-Tumor control slides

TS900-25 Set of 25
EUR 485

Breast Panel Multi-Tumor control slides

TS901 Set of 5
EUR 218

Breast Panel Multi-Tumor control slides

TS901-25 Set of 25
EUR 485

Recombinant purified Hepatitis Surface Antigen (HBsAg) protein control for WB

HBA11-C 100 ul
EUR 286

SeroDetect HCV-Ab Mixed Titer Verification Panel I (15 X 0.25 mL)

KZMC022 15 X 0.25 mL
EUR 266.32
  • What is the product classification?
  • SeroDetect HCV-Ab Mixed Titer Verification Panel I is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect HIV-1/ HIV-2 Ag/Ab Combo Verification Panel (5 X 1.25mL)

KZMC030 5 X 1.25mL
EUR 313.12
  • What is the product classification?
  • SeroDetect HIV-1/ HIV-2 Ag/Ab Combo Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Ivd/ Rat Ivd ELISA Kit

ELI-39421r 96 Tests
EUR 886

IVD siRNA

20-abx902738
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IVD siRNA

20-abx920988
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IVD siRNA

20-abx920989
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IVD antibody

22140-100ul 100ul
EUR 390

IVD antibody

10R-4491 100 ul
EUR 691
Description: Mouse monoclonal IVD antibody

IVD antibody

70R-18039 50 ul
EUR 435
Description: Rabbit polyclonal IVD antibody

IVD antibody

70R-13603 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal IVD antibody

IVD Antibody

DF12284 200ul
EUR 304
Description: IVD antibody detects endogenous levels of IVD.

IVD Antibody

1-CSB-PA011921GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

IVD Antibody

1-CSB-PA011921LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

anti-IVD

YF-PA12811 50 ug
EUR 363
Description: Mouse polyclonal to IVD

anti-IVD

YF-PA12812 100 ug
EUR 403
Description: Rabbit polyclonal to IVD

HRP-HBsAg

C050101-10ml 10ml
EUR 2635

HRP-HBsAg

C050101-1ml 1ml
EUR 438

HBsAg Protein

abx060551-1mg 1 mg
EUR 1553
  • Shipped within 5-10 working days.

HBsAg Protein

abx060552-1mg 1 mg
EUR 1010
  • Shipped within 5-10 working days.

HBsAg Protein

abx060560-1mg 1 mg
EUR 1121
  • Shipped within 5-10 working days.

HBsAg Protein

abx060562-1mg 1 mg
EUR 1567
  • Shipped within 5-10 working days.

HBsAg antibody

70R-HG003 1 mg
EUR 246
Description: Goat polyclonal HBsAg antibody

HBsAg antibody

10C-CR1279M1 100 ug
EUR 281
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-1323 1 mg
EUR 136
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-1324 1 mg
EUR 136
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-3128 1 mg
EUR 230
Description: Mouse Monoclonal HBsAg antibody

HBsAg antibody

10-3130 1 mg
EUR 230
Description: Mouse Monoclonal HBsAg antibody

HBsAg antibody

10-3131 1 mg
EUR 230
Description: Mouse Monoclonal HBsAg antibody

HBsAg antibody

10-7857 1 mg
EUR 314
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-7858 1 mg
EUR 306
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H05A 1 mg
EUR 220
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H05B 1 mg
EUR 220
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H05C 1 mg
EUR 592
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H05D 1 mg
EUR 220
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H05F 1 mg
EUR 220
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H05G 1 mg
EUR 228
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H05H 1 mg
EUR 228
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H05J 1 mg
EUR 192
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H05N 1 mg
EUR 220
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H114C 1 mg
EUR 336
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10-H114D 1 mg
EUR 325
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10R-H114c 1 mg
EUR 489
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

10R-H114d 1 mg
EUR 472
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody

20C-CR2100G 1 ml
EUR 133
Description: Goat polyclonal HBsAg antibody

HBsAg antibody

20C-CR2100GP 1 ml
EUR 427
Description: Goat polyclonal HBsAg antibody

HBsAg antibody

20-HR20 1 mg
EUR 337
Description: Rabbit polyclonal HBsAg antibody

HbsAg antibody

20R-2830 1 ml
EUR 565
Description: Goat polyclonal HbsAg antibody

HBsAg antibody

70-1088 1 mg
EUR 219
Description: Goat polyclonal HBsAg antibody

HBsAg antibody

70-HH15 1 mg
EUR 258
Description: Horse polyclonal HBsAg antibody

Hepatitis B Surface Antigen (HBsAg) pre-S1 peptide control/blocking peptide

HBVS12-P 100 ug
EUR 225

IVD cloning plasmid

CSB-CL011921HU-10ug 10ug
EUR 465
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1272
  • Sequence: atggcgactgcgactcggctgctggggtgtcgtgtggcgagctggaggctgcggccgccgcttgccggcttcgtttcccagcgggcccactcgcttttgcccgtggacgatgcaatcaatgggctaagcgaggagcagaggcagcttcgtcagaccatggctaagttccttcagg
  • Show more
Description: A cloning plasmid for the IVD gene.

anti- IVD antibody

FNab04426 100µg
EUR 505.25
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

anti- IVD antibody

FNab04427 100µg
EUR 585
  • Recommended dilution: WB: 1:1000-1:6000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

IVD Rabbit pAb

A15281-100ul 100 ul
EUR 308

IVD Rabbit pAb

A15281-200ul 200 ul
EUR 459

IVD Rabbit pAb

A15281-20ul 20 ul
EUR 183

IVD Rabbit pAb

A15281-50ul 50 ul
EUR 223

Human IVD Antibody

33170-05111 150 ug
EUR 261

IVD Polyclonal Antibody

28898-100ul 100ul
EUR 252

IVD Polyclonal Antibody

28898-50ul 50ul
EUR 187

IVD Blocking Peptide

DF12284-BP 1mg
EUR 195

Anti-IVD antibody

PAab04426 100 ug
EUR 355

Anti-IVD antibody

STJ117476 100 µl
EUR 277
Description: Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

IVD, Human Recombinant

P1577-100 100 µg
EUR 510

IVD, Human Recombinant

P1577-20 20 µg
EUR 156

Hepatitis B Surface Antigen (HBsAg) pre-S2 (55-aa) control/blocking peptide

HBVS23-P 100 ug
EUR 225

Human HBsAg Protein

abx060118-1mg 1 mg
EUR 411
  • Shipped within 5-10 working days.

HBsAg ad Protein

abx060555-100ug 100 ug
EUR 878
  • Shipped within 5-10 working days.

HBsAg adr Protein

abx060556-05mg 0.5 mg
EUR 1567
  • Shipped within 5-10 working days.

HBsAg adw Protein

abx060557-01mg 0.1 mg
EUR 1017
  • Shipped within 5-10 working days.

HBsAg adw Protein

abx060558-05mg 0.5 mg
EUR 1295
  • Shipped within 5-10 working days.

HBsAg ay Protein

abx060563-100ug 100 ug
EUR 815
  • Shipped within 5-10 working days.

HBsAg ayw Protein

abx060565-05mg 0.5 mg
EUR 1358
  • Shipped within 5-10 working days.

HBsAg ayw Protein

abx060566-05mg 0.5 mg
EUR 1497
  • Shipped within 5-10 working days.

HBsAg adw Protein

abx060567-1mg 1 mg
EUR 1017
  • Shipped within 5-10 working days.

HBsAg antibody (biotin)

61-1066 1 ml
EUR 133
Description: Mouse monoclonal HBsAg antibody (biotin-conjugated)

HBsAg antibody (biotin)

60C-CR2100GB 1 ml
EUR 457
Description: Goat polyclonal HBsAg antibody (biotin) conjugated

HBsAg antibody (FITC)

60C-CR2100GF 1 ml
EUR 363
Description: Goat polyclonal HBsAg antibody (FITC) conjugated

HBsAg antibody (HRP)

60C-CR2100GX 1 ml
EUR 451
Description: Goat polyclonal HBsAg antibody (HRP) conjugated

HBsAg antibody (biotin)

60C-CR2100RB 1 ml
EUR 453
Description: Rabbit polyclonal HBsAg antibody (biotin) conjugated

HBsAg antibody (FITC)

60C-CR2100RF 1 ml
EUR 385
Description: Rabbit polyclonal HBsAg antibody (FITC) conjugated

HBsAg antibody (HRP)

60C-CR2100RX 1 ml
EUR 445
Description: Rabbit polyclonal HBsAg antibody (HRP) conjugated

Anti-HBsAg antibody

STJ16101373 1 mg
EUR 538

Anti-HBsAg antibody

STJ180119 0.1 ml
EUR 212

ELISA kit for Human PLA2G4D (Phospholipase A2, Group IVD)

ELK6188 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phospholipase A2, Group IVD (PLA2G4D). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Phospholipase A2, Group IVD from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Goat IgG (-ve control for flow cytometry) (isotype control)

20011-100 100 test
EUR 103

IVD Polyclonal Conjugated Antibody

C28898 100ul
EUR 397

Mouse IVD shRNA Plasmid

20-abx974716
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat IVD shRNA Plasmid

20-abx984521
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human IVD ELISA KIT

ELI-12848h 96 Tests
EUR 824

Bovine IVD ELISA KIT

ELI-13527b 96 Tests
EUR 928

IVD ELISA KIT|Human

EF010406 96 Tests
EUR 689

Mouse Ivd ELISA KIT

ELI-43520m 96 Tests
EUR 865

IVD protein (His tag)

80R-1262 100 ug
EUR 268
Description: Purified recombinant Human IVD protein

Human IVD shRNA Plasmid

20-abx952499
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IVD Antibody, HRP conjugated

1-CSB-PA011921LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IVD Antibody, FITC conjugated

1-CSB-PA011921LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IVD Antibody, Biotin conjugated

1-CSB-PA011921LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

IVD Recombinant Protein (Human)

RP016447 100 ug Ask for price

IVD Recombinant Protein (Rat)

RP206471 100 ug Ask for price

IVD Recombinant Protein (Mouse)

RP144596 100 ug Ask for price

BSA Control for AGE-BSA

35R-AA007 10 mg
EUR 224
Description: BSA Control for AGE protein (BSA modified), Cat No. 30R-AA007

BSA Control for Age-BSA

2221-BSA
EUR 175

ELISA kit for Human HBsAg (Hepatitis B surface antigen)

E-EL-H1567 1 plate of 96 wells
EUR 534
  • Gentaur's HBsAg ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human HBsAg. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human HBsAg (Hepatitis B surface antigen) in samples from Serum, Plasma, Cell supernatant

Paraffin Tissue Section Panel - Mouse Whole Brain Segmentation Panel

T8334035 5 slides
EUR 556
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Frozen Tissue Section Panel - Mouse Whole Brain Segmentation Panel

T6334035 5 slides
EUR 931
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Polyclonal Goat Anti-HBsAg

C020108-10mg 10mg
EUR 1114

Polyclonal Goat Anti-HBsAg

C020108-1mg 1mg
EUR 269

Human HBsAg ELISA Kit

EHH0214 96Tests
EUR 521

Canine HBsAg Elisa Kit

ELA-E0940d 96 Tests
EUR 928

Goat HBsAg ELISA Kit

EGTH0214 96Tests
EUR 521

Bovine HBsAg ELISA Kit

EBH0214 96Tests
EUR 521

Canine HBsAg ELISA Kit

ECH0214 96Tests
EUR 521

Anserine HBsAg ELISA Kit

EAH0214 96Tests
EUR 521

HbsAg ELISA KIT|Human

EF007266 96 Tests
EUR 689

anti- HBsAg mouse antibody

HBV001 100µg
EUR 548.75
  • Immunogen: HBsAg
  • Research Area: Signal Transduction
Description: Antibody raised against HBsAg mouse

anti- HBsAg mouse antibody

HBV002 100µg
EUR 548.75
  • Immunogen: HBsAg
  • Research Area: Signal Transduction
Description: Antibody raised against HBsAg mouse

Porcine HBsAg ELISA Kit

EPH0214 96Tests
EUR 521

Rat HBsAg ELISA Kit

ERH0214 96Tests
EUR 521

Rabbit HBsAg ELISA Kit

ERTH0214 96Tests
EUR 521

Mouse HBsAg ELISA Kit

EMH0214 96Tests
EUR 521

HBV antigen HBsAg Antibody

abx140205-01mg 0.1 mg
EUR 328
  • Shipped within 5-12 working days.

HBV antigen HBsAg Antibody

abx140206-01mg 0.1 mg
EUR 328
  • Shipped within 5-12 working days.

Anti-HBsAg Antibody (1C10E2)

A1372-1000
EUR 479

Anti-HBsAg Antibody (1G1A10)

A1373-1000
EUR 479

Anti-HBsAg Antibody (3G9F6)

A1374-1000
EUR 479

Anti-HBsAg (HBV) Purified

11-328-C025 0.025 mg
EUR 90

Anti-HBsAg (HBV) Purified

11-328-C100 0.1 mg
EUR 140

Anti-HBsAg (HBV) Purified

11-329-C025 0.025 mg
EUR 90

Anti-HBsAg (HBV) Purified

11-329-C100 0.1 mg
EUR 140

HBsAg protein (Subtype adr)

30C-CP2019R 1 mg
EUR 573
Description: Purified recombinant HBsAg protein (Subtype adr)

HBsAg protein (Subtype adw)

30R-AH016 500 ug
EUR 732
Description: Purified recombinant HBsAg protein (Subtype adw)

HBsAg protein (Subtype ayw)

30R-AH018 500 ug
EUR 761
Description: Purified recombinant HBsAg protein (Subtype ayw)

HBsAg protein (subtype ad)

30-1815 500 ug
EUR 435
Description: Native Human HBsAg protein (Subtype ad)

HBsAg protein (Subtype ay)

30-1816 500 ug
EUR 381
Description: Purified Native Human HBsAg protein (Subtype ay)

HBsAg protein (Subtype ad)

30-AH15 1 mg
EUR 348
Description: Purified native Human HBsAg protein (Subtype ad)

HBsAg protein (Subtype adr)

30-AH37 1 mg
EUR 705
Description: Purified recombinant HBsAg protein (Subtype adr) (98% pure)

HBsAg antibody (Gold Colloid)

62-H05B 10 ml
EUR 457
Description: Mouse monoclonal HBsAg antibody (Gold Colloid)

Human HBsAg ELISA Kit

DEIA001 96T
EUR 485
Description: 1. For screening of blood donors. 2. As an aid in the diagnosis of liver disease.

Control for HER2, 4 cases (1.5mm)

HRC081 1
EUR 85
Description: IHC control array containing 4 breast cancer cases of strong, moderate, low and negative HER2 breast cancer expressers in duplicates

Control for ER, 4 cases (1.5mm)

ERC081 1
EUR 85
Description: IHC control array containing 4 breast cancer cases of strong, moderate, weak/nil estrogen receptor (ER) expressers in duplicates

SLLK, Control Peptide for TSP1 Inhibitor

HY-P0301 1mg
EUR 133

Control for DOG1, 3 cases (1.5mm)

DOG1061 1
EUR 85
Description: IHC control array containing 3 GIST cases of strong, moderate, weak/nil DOG1 expressers in duplicates

Control for Ckit, 6 samples (1.5mm)

CKIT061 1
EUR 85
Description: Gastrointestinal stroma tumors, 6 cores, 3 cases in duplicates showing strong, moderate and no expression of cKit molecule.

Control for PR, 3 cases (1.5mm)

PRC061 1
EUR 85
Description: IHC control array containing 3 breast cancer cases of strong, moderate, low/negative progesterone receptor (PR) expressers in duplicates

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-100 100 Slides
EUR 706

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-25 25 Slides
EUR 232

PAS/Glycogen, For Digestion (Control Slides)

TCS0024-5 5 Slides
EUR 98

Thiostatin Rat protein, control for western

TSTN11-C 100 ul
EUR 286

Control/Blocking peptide for Human WNT5a

WNT511-P 100 ug
EUR 164

Human IVD Antibody (Biotin Conjugate)

33170-05121 150 ug
EUR 369

IVD ORF Vector (Human) (pORF)

ORF005483 1.0 ug DNA
EUR 95

Ivd ORF Vector (Rat) (pORF)

ORF068825 1.0 ug DNA
EUR 506

Ivd ORF Vector (Mouse) (pORF)

ORF048200 1.0 ug DNA
EUR 506

ELISA kit for Canine hepatitis B virus surface antigen,HBsAg

EK0029 96 tests
EUR 830
Description: Enzyme-linked immunosorbent assay kit for quantification of Canine hepatitis B virus surface antigen,HBsAg in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human hepatitis B virus surface antigen,HBsAg

EK0216 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human hepatitis B virus surface antigen,HBsAg in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse hepatitis B virus surface antigen,HBsAg

EK0341 96 tests
EUR 830
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse hepatitis B virus surface antigen,HBsAg in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Hepatitis B surface antigen (HBsAg)  Kit 

KTE63050-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Human Hepatitis B surface antigen (HBsAg)  Kit  in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Hepatitis B surface antigen (HBsAg)  Kit 

KTE63050-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Hepatitis B surface antigen (HBsAg)  Kit  in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Hepatitis B surface antigen (HBsAg)  Kit 

KTE63050-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Human Hepatitis B surface antigen (HBsAg)  Kit  in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Ferret IgG (Control, non-immune, isotype control), semi-pure for ELISA

20021-1 100 ug
EUR 225