In vitro cross-resistance to doravirine in a panel of HIV-1 clones harbouring a number of NNRTI

The impact of the presence of kids on grownup smoking behaviour: empirical proof based mostly on China household panel research

Background: Regardless of numerous research linking household and marriage components with well being behaviour, the consequences of kids on the well being behaviour of fogeys are nonetheless understudied. This research explored the affiliation between the presence of kids and adults’ smoking behaviours.

 

Strategies: This research used panel information from the China Household Panel Research 2010 and 2012, and the info set included 23,157 households and 45,513 adults. Logistic regression was carried out to analyse the affiliation of the presence of kids on adults’ smoking behaviours. Subgroup regression was used to look at heterogeneous results.

 

Outcomes: Full pattern regressions confirmed that the variety of kids was considerably inversely related to smoking behaviour (OR = 0.93; 95% 0.90-0.96). Additional subsample regression finds that such impact is barely important among the many high-education group (OR = 0.92; 95% 0.87-0.97), high-skill staff (OR = 0.89; 95% 0.80-0.99) and {couples} who had an age hole higher than 2 years (OR = 0.91; 95% 0.88-0.95).

 

Conclusions: Our findings verify the existence of the upward intergenerational impact of the presence of kids on adults’ smoking behaviour in China. Nonetheless, such results are usually not equal throughout all demographic traits. Future analysis might discover different components of the upward mechanism and potential pathways for a stronger impact. In resource-poor areas, focusing on cessation actions at those that have kids at an early age could also be an efficient technique.

NATtrol Flu Verification Panel (7 X 0.5 mL)
NATFVP-NNS	Zeptometrix	7 X 0.5 mL	EUR 394.24
What is the product classification? NATtrol Flu Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Core Panel Multi-Tumor control slides
TS900	Innovex	Set of 5	EUR 218

Core Panel Multi-Tumor control slides
TS900-25	Innovex	Set of 25	EUR 485

Breast Panel Multi-Tumor control slides
TS901	Innovex	Set of 5	EUR 218

Breast Panel Multi-Tumor control slides
TS901-25	Innovex	Set of 25	EUR 485

Porcine Swine FLU virus A (FLU A) ELISA Kit
QY-E40037	Qayee Biotechnology	96T	EUR 400

Ivd/ Rat Ivd ELISA Kit
ELI-39421r	Lifescience Market	96 Tests	EUR 886

Human FLU ELISA Kit
EHF0241	Abclonal	96Tests	EUR 521

Goat FLU ELISA Kit
EGTF0241	Abclonal	96Tests	EUR 521

Canine FLU ELISA Kit
ECF0241	Abclonal	96Tests	EUR 521

Bovine FLU ELISA Kit
EBF0241	Abclonal	96Tests	EUR 521

Anserine FLU ELISA Kit
EAF0241	Abclonal	96Tests	EUR 521

Porcine FLU ELISA Kit
EPF0241	Abclonal	96Tests	EUR 521

Rat FLU ELISA Kit
ERF0241	Abclonal	96Tests	EUR 521

Rabbit FLU ELISA Kit
ERTF0241	Abclonal	96Tests	EUR 521

Mouse FLU ELISA Kit
EMF0241	Abclonal	96Tests	EUR 521

IVD siRNA
20-abx902738	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IVD siRNA
20-abx920988	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IVD siRNA
20-abx920989	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IVD antibody
22140-100ul	SAB	100ul	EUR 390

IVD antibody
10R-4491	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal IVD antibody

IVD antibody
70R-18039	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal IVD antibody

IVD antibody
70R-13603	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal IVD antibody

IVD Antibody
DF12284	Affbiotech	200ul	EUR 304
Description: IVD antibody detects endogenous levels of IVD.

IVD Antibody
1-CSB-PA011921GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

IVD Antibody
1-CSB-PA011921LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

anti-IVD
YF-PA12811	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to IVD

anti-IVD
YF-PA12812	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to IVD

Bordetella bronchiseptica proteins (inactivated vaccine for dog) for ELISA
BBV15-N-100	Alpha Diagnostics	100 ug	EUR 286

Guinea Pig FLU ELISA Kit
EGF0241	Abclonal	96Tests	EUR 521

Human FLU-H5 ELISA Kit
201-12-2128	SunredBio	96 tests	EUR 440
This FLU-H5 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

FLU-A DOT-ELISA Kit
DEIA436	Creative Diagnostics	6T/30T	EUR 580
Description: This kit is an in vitro immunoassay test (Dot-ELISA) for the direct, rapid and qualitative detection of nucleoprotein (NP) antigen of Influenza A Virus in human nasopharyngeal aspirates, swabs, nasal wash, chicken embryo whole virus inoculation or viral lysates, etc. It is intended for clinical identification influenza type-A viruses.

Human FLU-H5 ELISA Kit
QY-E04880	Qayee Biotechnology	96T	EUR 361

IVD cloning plasmid
CSB-CL011921HU-10ug	Cusabio	10ug	EUR 465
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1272 Sequence: atggcgactgcgactcggctgctggggtgtcgtgtggcgagctggaggctgcggccgccgcttgccggcttcgtttcccagcgggcccactcgcttttgcccgtggacgatgcaatcaatgggctaagcgaggagcagaggcagcttcgtcagaccatggctaagttccttcagg Show more
Description: A cloning plasmid for the IVD gene.

anti- IVD antibody
FNab04426	FN Test	100µg	EUR 505.25
Immunogen: isovaleryl Coenzyme A dehydrogenase Uniprot ID: P26440 Gene ID: 3712 Research Area: Metabolism
Description: Antibody raised against IVD

anti- IVD antibody
FNab04427	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:1000-1:6000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: isovaleryl Coenzyme A dehydrogenase Uniprot ID: P26440 Gene ID: 3712 Research Area: Metabolism
Description: Antibody raised against IVD

IVD Rabbit pAb
A15281-100ul	Abclonal	100 ul	EUR 308

IVD Rabbit pAb
A15281-200ul	Abclonal	200 ul	EUR 459

IVD Rabbit pAb
A15281-20ul	Abclonal	20 ul	EUR 183

IVD Rabbit pAb
A15281-50ul	Abclonal	50 ul	EUR 223

Human IVD Antibody
33170-05111	AssayPro	150 ug	EUR 261

IVD Polyclonal Antibody
28898-100ul	SAB	100ul	EUR 252

IVD Polyclonal Antibody
28898-50ul	SAB	50ul	EUR 187

IVD Blocking Peptide
DF12284-BP	Affbiotech	1mg	EUR 195

Anti-IVD antibody
PAab04426	Lifescience Market	100 ug	EUR 355

Anti-IVD antibody
STJ117476	St John's Laboratory	100 µl	EUR 277
Description: Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

IVD, Human Recombinant
P1577-100	Biovision	100 µg	EUR 510

IVD, Human Recombinant
P1577-20	Biovision	20 µg	EUR 156

Saponin Vaccine Adjuvant
VAdv-Ly0009	Creative Biolabs	1 g	EUR 1095
Description: Saponin Vaccine Adjuvant, plant-based vaccine adjuvant.

Recombinant flagellin FlicC vaccine adjuvant (TLR5 agonist); vaccine adjuvant
AV-7010-50	Alpha Diagnostics	50 ug	EUR 895

ELISA kit for Human PLA2G4D (Phospholipase A2, Group IVD)
ELK6188	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phospholipase A2, Group IVD (PLA2G4D). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Phospholipase A2, Group IVD from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Goat IgG (-ve control for flow cytometry) (isotype control)
20011-100	Alpha Diagnostics	100 test	EUR 103

IVD Polyclonal Conjugated Antibody
C28898	SAB	100ul	EUR 397

Mouse IVD shRNA Plasmid
20-abx974716	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat IVD shRNA Plasmid
20-abx984521	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human IVD ELISA KIT
ELI-12848h	Lifescience Market	96 Tests	EUR 824

Bovine IVD ELISA KIT
ELI-13527b	Lifescience Market	96 Tests	EUR 928

IVD ELISA KIT|Human
EF010406	Lifescience Market	96 Tests	EUR 689

Mouse Ivd ELISA KIT
ELI-43520m	Lifescience Market	96 Tests	EUR 865

IVD protein (His tag)
80R-1262	Fitzgerald	100 ug	EUR 268
Description: Purified recombinant Human IVD protein

Human IVD shRNA Plasmid
20-abx952499	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

IVD Antibody, HRP conjugated
1-CSB-PA011921LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IVD Antibody, FITC conjugated
1-CSB-PA011921LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IVD Antibody, Biotin conjugated
1-CSB-PA011921LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

IVD Recombinant Protein (Human)
RP016447	ABM	100 ug	Ask for price

IVD Recombinant Protein (Rat)
RP206471	ABM	100 ug	Ask for price

IVD Recombinant Protein (Mouse)
RP144596	ABM	100 ug	Ask for price

BSA Control for AGE-BSA
35R-AA007	Fitzgerald	10 mg	EUR 224
Description: BSA Control for AGE protein (BSA modified), Cat No. 30R-AA007

BSA Control for Age-BSA
2221-BSA	Biovision		EUR 175

Calcium phosphate vaccine adjuvant
AV-1020-100	Alpha Diagnostics	100 ml	EUR 219

Peanut Oil vaccine adjuvant
AV-5010-50	Alpha Diagnostics	50 ml	EUR 225

Mineral Oil vaccine adjuvant
AV-5020-50	Alpha Diagnostics	50 ml	EUR 225

Mannide monooleate vaccine adjuvant
AV-5030-5	Alpha Diagnostics	5 g	EUR 164

HS15 Kolliphore vaccine adjuvant
AV-6010-100	Alpha Diagnostics	100 g	EUR 286

Pam2CSK4 vaccine adjuvant, unlabeled
AV-9020-1	Alpha Diagnostics	1 mg	EUR 408

Pam3CSK4 vaccine adjuvant, unlabeled
AV-9025-1	Alpha Diagnostics	1 mg	EUR 286

Mouse Monoclonal Anti-Gardasil vaccine L1s (Human Papilloma Virus/HPV6+11+16+18 late proteins) antiserum control for ELISA
HPV618L13-S	Alpha Diagnostics	1 ml	EUR 469

Human Influenza viruses IgG(FLU)ELISA Kit
GA-E1783HM-48T	GenAsia Biotech	48T	EUR 289

Human Influenza viruses IgG(FLU)ELISA Kit
GA-E1783HM-96T	GenAsia Biotech	96T	EUR 466

Pig Swine Influenza Virus (FLU) ELISA Kit
abx157184-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-10 working days.

Human Influenza viruses IgG,FLU ELISA Kit
201-12-1767	SunredBio	96 tests	EUR 440
This Influenza viruses IgG ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Influenza viruses IgG(FLU)ELISA Kit
QY-E02255	Qayee Biotechnology	96T	EUR 361

Paraffin Tissue Section Panel - Mouse Whole Brain Segmentation Panel
T8334035	Biochain	5 slides	EUR 556
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Frozen Tissue Section Panel - Mouse Whole Brain Segmentation Panel
T6334035	Biochain	5 slides	EUR 931
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Rabbit Anti-West Nile Virus vaccine (WNV, Recombitek/DNA vaccine) antiserum
WNV13-S	Alpha Diagnostics	100 ul	EUR 457

Control for HER2, 4 cases (1.5mm)
HRC081	Pantomics	1	EUR 85
Description: IHC control array containing 4 breast cancer cases of strong, moderate, low and negative HER2 breast cancer expressers in duplicates

Control for ER, 4 cases (1.5mm)
ERC081	Pantomics	1	EUR 85
Description: IHC control array containing 4 breast cancer cases of strong, moderate, weak/nil estrogen receptor (ER) expressers in duplicates

SLLK, Control Peptide for TSP1 Inhibitor
HY-P0301	MedChemExpress	1mg	EUR 133

Control for DOG1, 3 cases (1.5mm)
DOG1061	Pantomics	1	EUR 85
Description: IHC control array containing 3 GIST cases of strong, moderate, weak/nil DOG1 expressers in duplicates

Control for Ckit, 6 samples (1.5mm)
CKIT061	Pantomics	1	EUR 85
Description: Gastrointestinal stroma tumors, 6 cores, 3 cases in duplicates showing strong, moderate and no expression of cKit molecule.

Control for PR, 3 cases (1.5mm)
PRC061	Pantomics	1	EUR 85
Description: IHC control array containing 3 breast cancer cases of strong, moderate, low/negative progesterone receptor (PR) expressers in duplicates

PAS/Glycogen, For Digestion (Control Slides)
TCS0024-100	ScyTek Laboratories	100 Slides	EUR 706

PAS/Glycogen, For Digestion (Control Slides)
TCS0024-25	ScyTek Laboratories	25 Slides	EUR 232

PAS/Glycogen, For Digestion (Control Slides)
TCS0024-5	ScyTek Laboratories	5 Slides	EUR 98

Thiostatin Rat protein, control for western
TSTN11-C	Alpha Diagnostics	100 ul	EUR 286

Control/Blocking peptide for Human WNT5a
WNT511-P	Alpha Diagnostics	100 ug	EUR 164

Human IVD Antibody (Biotin Conjugate)
33170-05121	AssayPro	150 ug	EUR 369

IVD ORF Vector (Human) (pORF)
ORF005483	ABM	1.0 ug DNA	EUR 95

Ivd ORF Vector (Rat) (pORF)
ORF068825	ABM	1.0 ug DNA	EUR 506

Ivd ORF Vector (Mouse) (pORF)
ORF048200	ABM	1.0 ug DNA	EUR 506

Peptidoglycan (S. aureus); vaccine adjuvant
AV-7045-25	Alpha Diagnostics	25 mg	EUR 1017

Peptidoglycan (S. aureus); vaccine adjuvant
AV-7045-5	Alpha Diagnostics	5 mg	EUR 286

RWJ 21757 Synthetic vaccine adjuvant
AV-9010-1	Alpha Diagnostics	1 mg	EUR 164

RWJ 21757 Synthetic vaccine adjuvant
AV-9010-5	Alpha Diagnostics	5 mg	EUR 286

Pam2CSK4 vaccine adjuvant; Biotin conjugate
AV-9020-B	Alpha Diagnostics	1 mg	EUR 408

Pam2CSK4 vaccine adjuvant; Biotin conjugate
AV-9020-B-100	Alpha Diagnostics	100 ug	EUR 164

Pam3CSK4 vaccine adjuvant; Biotin labelled
AV-9025-B	Alpha Diagnostics	100 ug	EUR 347

Pam3CSK4 vaccine adjuvant; FITC labelled
AV-9025-F	Alpha Diagnostics	100 ug	EUR 347

Pertussis Toxin B.Pertussis, vaccine grade
AV-9130-50	Alpha Diagnostics	50 ug	EUR 529

Human Influenza viruses A(FLU A)ELISA Kit
GA-E1612HM-48T	GenAsia Biotech	48T	EUR 289

Human Influenza viruses A(FLU A)ELISA Kit
GA-E1612HM-96T	GenAsia Biotech	96T	EUR 466

Human Influenza viruses A,FLU A ELISA Kit
201-12-1596	SunredBio	96 tests	EUR 440
This Influenza viruses A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Influenza viruses B,FLU B ELISA Kit
201-12-2058	SunredBio	96 tests	EUR 440
This Influenza viruses B ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Influenza viruses B(FLU B)ELISA Kit
QY-E02256	Qayee Biotechnology	96T	EUR 361

Human Influenza viruses A(FLU A)ELISA Kit
QY-E02257	Qayee Biotechnology	96T	EUR 361

Ferret IgG (Control, non-immune, isotype control), semi-pure for ELISA
20021-1	Alpha Diagnostics	100 ug	EUR 225

Elk IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20024-1	Alpha Diagnostics	100 ug	EUR 225

Deer IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20024-2	Alpha Diagnostics	100 ug	EUR 225

Bison IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20025-1	Alpha Diagnostics	100 ug	EUR 225

Raccoon IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20026-1	Alpha Diagnostics	100 ug	EUR 225

Skunk IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20027-1	Alpha Diagnostics	100 ug	EUR 225

Rabbit Anti-Gardasil vaccine (merck) antiserum (Human Papilloma Virus 16+18 (HPV16/18) late proteins L1 (HPV16+18L1) control for ELISA
HPV16181-S	Alpha Diagnostics	500 ul	EUR 469

Multiplex ELISA Kit For Human Cytokine Panel 1 (6-Plex)
MEK1010	BosterBio	1 kit	EUR 1084

Multiplex ELISA Kit For Mouse Cytokine Panel 1 (6-Plex)
MEK1011	BosterBio	1 kit	EUR 1084

Multiplex ELISA Kit For Human Cytokine Panel 2 (6-Plex)
MEK1012	BosterBio	1 kit	EUR 1084

Multiplex ELISA Kit For Mouse Cytokine Panel 2 (6-Plex)
MEK1013	BosterBio	1 kit	EUR 1084

Multiplex ELISA Kit For Mouse Cytokine Panel 1 (4-Plex)
MEK1015	BosterBio	1 kit	EUR 879

Multiplex ELISA Kit For Mouse Cytokine Panel 2 (4-Plex)
MEK1016	BosterBio	1 kit	EUR 879

Holder for Plasmid Midi, Maxi and Maxi plus, Ion Exchange column
FAPDE-holder-for-ion-exchange	Favorgen	1 prep	EUR 158

Human Anti-Merozoite surface protein-1 (MSP-1; P. falciparum/malaria vaccine) IgG antiserum negative control
970-360-01N	Alpha Diagnostics	1 ml	EUR 164

Human Anti-Merozoite surface protein-1 (MSP-1; P. falciparum/malaria vaccine) IgG antiserum positive control
970-360-02P	Alpha Diagnostics	1 ml	EUR 225

Human Anti-Merozoite surface protein-1 (MSP-1; P. falciparum/malaria vaccine) IgM antiserum negative control
970-370-01N	Alpha Diagnostics	1 ml	EUR 164

Human Anti-Merozoite surface protein-1 (MSP-1; P. falciparum/malaria vaccine) IgM antiserum positive control
970-370-02P	Alpha Diagnostics	1 ml	EUR 225

Human Apolipoprotein B protein control for WB
APOB21-C	Alpha Diagnostics	100 ul	EUR 286

Rec. Human CD21 protein control for WB
CD21-C	Alpha Diagnostics	100 ul	EUR 286

Bovine Adenosine deaminase protein control for Western
ADA11-C	Alpha Diagnostics	100 ul	EUR 286

Haptoglobin Human Plasma protein control for WB
HGLB18-C	Alpha Diagnostics	100 ul	EUR 286

Human Hemopexin purified protein control for Western
HPEX11-C	Alpha Diagnostics	100 ul	EUR 286

Hemopexin Mouse, purified protein control for Western
HPEX16-C	Alpha Diagnostics	100 ul	EUR 286

Purified Flagellin (salmonella) protein control for WB
FLGN17-C	Alpha Diagnostics	100 ul	EUR 286

SLLK, Control Peptide for TSP1 Inhibitor(TFA)
HY-P0301A	MedChemExpress	5mg	EUR 380

Mouse IgG (-ve control for flow cytometry)
20008-1-100	Alpha Diagnostics	100 tests	EUR 103

Rabbit IgG (-ve control for flow cytometry)
20009-1-100	Alpha Diagnostics	100 tests	EUR 103

Mouse Ceruloplasmin protein control for western blot
CP16-C	Alpha Diagnostics	100 ul	EUR 286

Rat Ceruloplasmin protein control for western blot
CP17-C	Alpha Diagnostics	100 ul	EUR 286

Control/Blocking peptide for Ephrin-B2 antibody
NIVE2B-C	Alpha Diagnostics	100 ug	EUR 164

Mouse negative control sera (purified) for IHC
NCM802M	Innovex	7 ml	EUR 199

Positive Control for Anti-Human CYP1A2 Antibody
P1A2CON	Detroit R&D	100 uL	EUR 125

Control Sections for FD NeuroSilver™ Kit
PCS101	FD Neurotechnologies	each	EUR 53.83
Description: Best quality products

Positive Control for Anti-Human CYP1B1 Antibody
PH1B1CON	Detroit R&D	100 uL	EUR 125

Positive Control for Anti-Rat MEH Antibody
MEHCON	Detroit R&D	100 uL	EUR 125

Purified bovine Lactoferrin protein control for Western
LTF13-C	Alpha Diagnostics	100 ul	EUR 286

Chicken Egg Ovalbumin protein control for Western
OVA11-C	Alpha Diagnostics	100 ul	EUR 286

Positive Control for Anti-Rat CYP2B1 Antibody
P2B1PTCON	Detroit R&D	100 uL	EUR 125

Positive Control for Anti-Rat CYP2C Antibody
P2CCON	Detroit R&D	100 uL	EUR 125

Positive Control for Anti-Rat CYP2D Antibody
P2DCON	Detroit R&D	100 uL	EUR 125

Positive Control for Anti-Human CYP2E1 Antibody
P2E1PTCON	Detroit R&D	100 uL	EUR 125

Positive Control for Anti-Rat CYP3A2 Antibody
P3A2PTCON	Detroit R&D	100 uL	EUR 125

Positive Control for Anti-Human CYP3A Antibody
P3ACON	Detroit R&D	100 uL	EUR 125

Purified, Bovine S100 protein control for WB
S1001-C	Alpha Diagnostics	100 ul	EUR 286

Purified, Human S100 protein control for WB
S1002-C	Alpha Diagnostics	100 ul	EUR 286

Control/Blocking peptide for Mouse Vimentin (Vim)
VIM11-C	Alpha Diagnostics	100 ug	EUR 164

Control/Blocking peptide for Human WNT-1
WNT111-P	Alpha Diagnostics	100 ug	EUR 457

Isovaleryl Coenzyme A Dehydrogenase (IVD) Antibody
20-abx113287	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Phospholipase A2, Group Ivd (Cytosolic) Antibody
20-abx114481	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

In vitro cross-resistance to doravirine in a panel of HIV-1 clones harbouring a number of NNRTI resistance mutations

Aims: Doravirine is a not too long ago licensed HIV-1 NNRTI with improved efficacy, pharmacokinetics and security profile in contrast with efavirenz and restricted cross-resistance with rilpivirine and etravirine. On this in vitro research, cross-resistance to doravirine was analysed in a consultant panel of NNRTI-resistant clones.

 

Strategies: In vitro phenotypic susceptibility to doravirine was assessed in 10 clinically derived infectious clones with intermediate- to high-level resistance to rilpivirine, etravirine, efavirenz and nevirapine, and in NL4-Three site-directed mutants harbouring Ok103N, Y181C, M230L or Ok103N/Y181C NNRTI mutations

 

Outcomes: Though not one of the infectious clones harboured any of the foremost doravirine resistance-associated mutations (RAMs) included within the IAS-USA reference record, doravirine fold change (FC) values had been akin to or larger than these calculated for different NNRTIs, notably etravirine and rilpivirine.

 

As anticipated, single NNRTI mutations Ok103N and Y181C didn’t impair doravirine susceptibility (FC 1.Four and 1.8, respectively), whereas lowered exercise was noticed with the only M230L or double Ok103N/Y181C mutations (FC 7.6 and 4.9, respectively). Median FC values elevated considerably with growing numbers of NNRTI RAMs (P = 0.005) and had been >10 in 4/Four and 1/Four clones harbouring 4 and three NNRTI RAMs, respectively. FC values correlated effectively with predicted susceptibility as inferred by Stanford HIV Drug Resistance Database (HIVdb) and ANRS algorithms (each P < 0.001).

 

Conclusions: Substantial cross-resistance to doravirine was detected in NNRTI-resistant viruses harbouring advanced mutational patterns, even within the absence of main IAS-USA doravirine RAMs. Due to this fact, based mostly on the straightforward IAS-USA reference record, doravirine resistance could also be underestimated in viruses harbouring a number of NNRTI mutations.

Affiliation between modifications in financial exercise and catastrophic well being expenditure: findings from the Korea Well being Panel Survey, 2014-2016

 

Background: The speed of catastrophic well being expenditure (CHE) continues to rise in South Korea. This research examined the affiliation between modifications in financial exercise and CHE experiences in South Korea.

 

Strategies: This research analyzed the Korea Well being Panel Survey information utilizing a logistic regression evaluation to review the affiliation between modifications in financial exercise in 2014-2015 and the members‘ CHE experiences in 2015. The research included a complete of 12,454 people over the age of 19. The subgroup analyses had been organized by intercourse, age, health-related variables, and family stage variables, and the explanations for leaving financial exercise.

 

Outcomes: Those that give up financial actions had been extra more likely to expertise CHE than those that continued to have interaction in financial actions (OR [odds ratio] = 2.10; 95% CI [confidence interval]: 1.31-3.36). The subgroup evaluation outcomes, in line with health-related variables, confirmed that there’s a tendency to a better Charlson comorbidity index, a better OR, and, in teams that give up their financial actions, folks with disabilities had been extra more likely to expertise CHE than folks with out disabilities (OR = 5.63; 95% CI 1.71-18.59, OR = 1.82; 95% CI 1.08-3.08, respectively).

 

One other subgroup evaluation discovered that if the rationale for not taking part in financial exercise was a health-related subject, the participant was extra more likely to expertise CHE (energetic → inactive: OR = 2.40; 95% CI 0.61-9.43, inactive → inactive OR = 1.65; 95% CI 1.01-2.68).

 

 

Conclusions: These people who grew to become unemployed had been extra more likely to expertise CHE, particularly if well being issues precipitated the job loss. Due to this fact, efforts are wanted to increase protection for these individuals who endure from excessive medical bills.

Positive control tissue section for each antibody; Based on availability INQUIRE
Control-Slides	Innovex	Set of 5	EUR 176

SeroDetect HIV-Ab Verification Panel (5 X 1.5 mL)
KZMC006	Zeptometrix	5 X 1.5 mL	EUR 278.8
What is the product classification? SeroDetect HIV-Ab Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect Anti-HBs Verification Panel (6 X 1.5 mL)
KZMC008	Zeptometrix	6 X 1.5 mL	EUR 278.8
What is the product classification? SeroDetect Anti-HBs Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect Anti-HBcore Verification Panel (5 X 1.5 mL)
KZMC009	Zeptometrix	5 X 1.5 mL	EUR 278.8
What is the product classification? SeroDetect Anti-HBcore Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect Anti-HCV Verification Panel (5 X 1.5 mL)
KZMC010	Zeptometrix	5 X 1.5 mL	EUR 278.8
What is the product classification? SeroDetect Anti-HCV Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect HTLV Ab Verification Panel (5 X 1.5 mL)
KZMC011	Zeptometrix	5 X 1.5 mL	EUR 278.8
What is the product classification? SeroDetect HTLV Ab Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect Dengue Fever Verification Panel (10 X 0.5 mL)
KZMC028	Zeptometrix	10 X 0.5 mL	EUR 272.56
What is the product classification? SeroDetect Dengue Fever Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect HIV-Ab Range Verification Panel (10 X 1.5 mL)
KZMC024	Zeptometrix	10 X 1.5 mL	EUR 278.8
What is the product classification? SeroDetect HIV-Ab Range Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect West Nile Virus Verification Panel (10 X 0.5 mL)
KZMC027	Zeptometrix	10 X 0.5 mL	EUR 278.8
What is the product classification? SeroDetect West Nile Virus Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Core Panel Multi-Tumor control slides
TS900	Innovex	Set of 5	EUR 218

Core Panel Multi-Tumor control slides
TS900-25	Innovex	Set of 25	EUR 485

Breast Panel Multi-Tumor control slides
TS901	Innovex	Set of 5	EUR 218

Breast Panel Multi-Tumor control slides
TS901-25	Innovex	Set of 25	EUR 485

Recombinant purified Hepatitis Surface Antigen (HBsAg) protein control for WB
HBA11-C	Alpha Diagnostics	100 ul	EUR 286

SeroDetect HCV-Ab Mixed Titer Verification Panel I (15 X 0.25 mL)
KZMC022	Zeptometrix	15 X 0.25 mL	EUR 266.32
What is the product classification? SeroDetect HCV-Ab Mixed Titer Verification Panel I is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

SeroDetect HIV-1/ HIV-2 Ag/Ab Combo Verification Panel (5 X 1.25mL)
KZMC030	Zeptometrix	5 X 1.25mL	EUR 313.12
What is the product classification? SeroDetect HIV-1/ HIV-2 Ag/Ab Combo Verification Panel is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Ivd/ Rat Ivd ELISA Kit
ELI-39421r	Lifescience Market	96 Tests	EUR 886

IVD siRNA
20-abx902738	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IVD siRNA
20-abx920988	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IVD siRNA
20-abx920989	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IVD antibody
22140-100ul	SAB	100ul	EUR 390

IVD antibody
10R-4491	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal IVD antibody

IVD antibody
70R-18039	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal IVD antibody

IVD antibody
70R-13603	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal IVD antibody

IVD Antibody
DF12284	Affbiotech	200ul	EUR 304
Description: IVD antibody detects endogenous levels of IVD.

IVD Antibody
1-CSB-PA011921GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

IVD Antibody
1-CSB-PA011921LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

anti-IVD
YF-PA12811	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to IVD

anti-IVD
YF-PA12812	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to IVD

HRP-HBsAg
C050101-10ml	Unibiotest	10ml	EUR 2635

HRP-HBsAg
C050101-1ml	Unibiotest	1ml	EUR 438

HBsAg Protein
abx060551-1mg	Abbexa	1 mg	EUR 1553
Shipped within 5-10 working days.

HBsAg Protein
abx060552-1mg	Abbexa	1 mg	EUR 1010
Shipped within 5-10 working days.

HBsAg Protein
abx060560-1mg	Abbexa	1 mg	EUR 1121
Shipped within 5-10 working days.

HBsAg Protein
abx060562-1mg	Abbexa	1 mg	EUR 1567
Shipped within 5-10 working days.

HBsAg antibody
70R-HG003	Fitzgerald	1 mg	EUR 246
Description: Goat polyclonal HBsAg antibody

HBsAg antibody
10C-CR1279M1	Fitzgerald	100 ug	EUR 281
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody
10-1323	Fitzgerald	1 mg	EUR 136
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody
10-1324	Fitzgerald	1 mg	EUR 136
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody
10-3128	Fitzgerald	1 mg	EUR 230
Description: Mouse Monoclonal HBsAg antibody

HBsAg antibody
10-3130	Fitzgerald	1 mg	EUR 230
Description: Mouse Monoclonal HBsAg antibody

HBsAg antibody
10-3131	Fitzgerald	1 mg	EUR 230
Description: Mouse Monoclonal HBsAg antibody

HBsAg antibody
10-7857	Fitzgerald	1 mg	EUR 314
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody
10-7858	Fitzgerald	1 mg	EUR 306
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody
10-H05A	Fitzgerald	1 mg	EUR 220
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody
10-H05B	Fitzgerald	1 mg	EUR 220
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody
10-H05C	Fitzgerald	1 mg	EUR 592
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody
10-H05D	Fitzgerald	1 mg	EUR 220
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody
10-H05F	Fitzgerald	1 mg	EUR 220
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody
10-H05G	Fitzgerald	1 mg	EUR 228
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody
10-H05H	Fitzgerald	1 mg	EUR 228
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody
10-H05J	Fitzgerald	1 mg	EUR 192
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody
10-H05N	Fitzgerald	1 mg	EUR 220
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody
10-H114C	Fitzgerald	1 mg	EUR 336
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody
10-H114D	Fitzgerald	1 mg	EUR 325
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody
10R-H114c	Fitzgerald	1 mg	EUR 489
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody
10R-H114d	Fitzgerald	1 mg	EUR 472
Description: Mouse monoclonal HBsAg antibody

HBsAg antibody
20C-CR2100G	Fitzgerald	1 ml	EUR 133
Description: Goat polyclonal HBsAg antibody

HBsAg antibody
20C-CR2100GP	Fitzgerald	1 ml	EUR 427
Description: Goat polyclonal HBsAg antibody

HBsAg antibody
20-HR20	Fitzgerald	1 mg	EUR 337
Description: Rabbit polyclonal HBsAg antibody

HbsAg antibody
20R-2830	Fitzgerald	1 ml	EUR 565
Description: Goat polyclonal HbsAg antibody

HBsAg antibody
70-1088	Fitzgerald	1 mg	EUR 219
Description: Goat polyclonal HBsAg antibody

HBsAg antibody
70-HH15	Fitzgerald	1 mg	EUR 258
Description: Horse polyclonal HBsAg antibody

Hepatitis B Surface Antigen (HBsAg) pre-S1 peptide control/blocking peptide
HBVS12-P	Alpha Diagnostics	100 ug	EUR 225

IVD cloning plasmid
CSB-CL011921HU-10ug	Cusabio	10ug	EUR 465
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1272 Sequence: atggcgactgcgactcggctgctggggtgtcgtgtggcgagctggaggctgcggccgccgcttgccggcttcgtttcccagcgggcccactcgcttttgcccgtggacgatgcaatcaatgggctaagcgaggagcagaggcagcttcgtcagaccatggctaagttccttcagg Show more
Description: A cloning plasmid for the IVD gene.

anti- IVD antibody
FNab04426	FN Test	100µg	EUR 505.25
Immunogen: isovaleryl Coenzyme A dehydrogenase Uniprot ID: P26440 Gene ID: 3712 Research Area: Metabolism
Description: Antibody raised against IVD

anti- IVD antibody
FNab04427	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:1000-1:6000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: isovaleryl Coenzyme A dehydrogenase Uniprot ID: P26440 Gene ID: 3712 Research Area: Metabolism
Description: Antibody raised against IVD

IVD Rabbit pAb
A15281-100ul	Abclonal	100 ul	EUR 308

IVD Rabbit pAb
A15281-200ul	Abclonal	200 ul	EUR 459

IVD Rabbit pAb
A15281-20ul	Abclonal	20 ul	EUR 183

IVD Rabbit pAb
A15281-50ul	Abclonal	50 ul	EUR 223

Human IVD Antibody
33170-05111	AssayPro	150 ug	EUR 261

IVD Polyclonal Antibody
28898-100ul	SAB	100ul	EUR 252

IVD Polyclonal Antibody
28898-50ul	SAB	50ul	EUR 187

IVD Blocking Peptide
DF12284-BP	Affbiotech	1mg	EUR 195

Anti-IVD antibody
PAab04426	Lifescience Market	100 ug	EUR 355

Anti-IVD antibody
STJ117476	St John's Laboratory	100 µl	EUR 277
Description: Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

IVD, Human Recombinant
P1577-100	Biovision	100 µg	EUR 510

IVD, Human Recombinant
P1577-20	Biovision	20 µg	EUR 156

Hepatitis B Surface Antigen (HBsAg) pre-S2 (55-aa) control/blocking peptide
HBVS23-P	Alpha Diagnostics	100 ug	EUR 225

Human HBsAg Protein
abx060118-1mg	Abbexa	1 mg	EUR 411
Shipped within 5-10 working days.

HBsAg ad Protein
abx060555-100ug	Abbexa	100 ug	EUR 878
Shipped within 5-10 working days.

HBsAg adr Protein
abx060556-05mg	Abbexa	0.5 mg	EUR 1567
Shipped within 5-10 working days.

HBsAg adw Protein
abx060557-01mg	Abbexa	0.1 mg	EUR 1017
Shipped within 5-10 working days.

HBsAg adw Protein
abx060558-05mg	Abbexa	0.5 mg	EUR 1295
Shipped within 5-10 working days.

HBsAg ay Protein
abx060563-100ug	Abbexa	100 ug	EUR 815
Shipped within 5-10 working days.

HBsAg ayw Protein
abx060565-05mg	Abbexa	0.5 mg	EUR 1358
Shipped within 5-10 working days.

HBsAg ayw Protein
abx060566-05mg	Abbexa	0.5 mg	EUR 1497
Shipped within 5-10 working days.

HBsAg adw Protein
abx060567-1mg	Abbexa	1 mg	EUR 1017
Shipped within 5-10 working days.

HBsAg antibody (biotin)
61-1066	Fitzgerald	1 ml	EUR 133
Description: Mouse monoclonal HBsAg antibody (biotin-conjugated)

HBsAg antibody (biotin)
60C-CR2100GB	Fitzgerald	1 ml	EUR 457
Description: Goat polyclonal HBsAg antibody (biotin) conjugated

HBsAg antibody (FITC)
60C-CR2100GF	Fitzgerald	1 ml	EUR 363
Description: Goat polyclonal HBsAg antibody (FITC) conjugated

HBsAg antibody (HRP)
60C-CR2100GX	Fitzgerald	1 ml	EUR 451
Description: Goat polyclonal HBsAg antibody (HRP) conjugated

HBsAg antibody (biotin)
60C-CR2100RB	Fitzgerald	1 ml	EUR 453
Description: Rabbit polyclonal HBsAg antibody (biotin) conjugated

HBsAg antibody (FITC)
60C-CR2100RF	Fitzgerald	1 ml	EUR 385
Description: Rabbit polyclonal HBsAg antibody (FITC) conjugated

HBsAg antibody (HRP)
60C-CR2100RX	Fitzgerald	1 ml	EUR 445
Description: Rabbit polyclonal HBsAg antibody (HRP) conjugated

Anti-HBsAg antibody
STJ16101373	St John's Laboratory	1 mg	EUR 538

Anti-HBsAg antibody
STJ180119	St John's Laboratory	0.1 ml	EUR 212

ELISA kit for Human PLA2G4D (Phospholipase A2, Group IVD)
ELK6188	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phospholipase A2, Group IVD (PLA2G4D). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Phospholipase A2, Group IVD from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Goat IgG (-ve control for flow cytometry) (isotype control)
20011-100	Alpha Diagnostics	100 test	EUR 103

IVD Polyclonal Conjugated Antibody
C28898	SAB	100ul	EUR 397

Mouse IVD shRNA Plasmid
20-abx974716	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat IVD shRNA Plasmid
20-abx984521	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human IVD ELISA KIT
ELI-12848h	Lifescience Market	96 Tests	EUR 824

Bovine IVD ELISA KIT
ELI-13527b	Lifescience Market	96 Tests	EUR 928

IVD ELISA KIT|Human
EF010406	Lifescience Market	96 Tests	EUR 689

Mouse Ivd ELISA KIT
ELI-43520m	Lifescience Market	96 Tests	EUR 865

IVD protein (His tag)
80R-1262	Fitzgerald	100 ug	EUR 268
Description: Purified recombinant Human IVD protein

Human IVD shRNA Plasmid
20-abx952499	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

IVD Antibody, HRP conjugated
1-CSB-PA011921LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IVD Antibody, FITC conjugated
1-CSB-PA011921LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IVD Antibody, Biotin conjugated
1-CSB-PA011921LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

IVD Recombinant Protein (Human)
RP016447	ABM	100 ug	Ask for price

IVD Recombinant Protein (Rat)
RP206471	ABM	100 ug	Ask for price

IVD Recombinant Protein (Mouse)
RP144596	ABM	100 ug	Ask for price

BSA Control for AGE-BSA
35R-AA007	Fitzgerald	10 mg	EUR 224
Description: BSA Control for AGE protein (BSA modified), Cat No. 30R-AA007

BSA Control for Age-BSA
2221-BSA	Biovision		EUR 175

ELISA kit for Human HBsAg (Hepatitis B surface antigen)
E-EL-H1567	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's HBsAg ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human HBsAg. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human HBsAg (Hepatitis B surface antigen) in samples from Serum, Plasma, Cell supernatant

Paraffin Tissue Section Panel - Mouse Whole Brain Segmentation Panel
T8334035	Biochain	5 slides	EUR 556
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Frozen Tissue Section Panel - Mouse Whole Brain Segmentation Panel
T6334035	Biochain	5 slides	EUR 931
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Polyclonal Goat Anti-HBsAg
C020108-10mg	Unibiotest	10mg	EUR 1114

Polyclonal Goat Anti-HBsAg
C020108-1mg	Unibiotest	1mg	EUR 269

Human HBsAg ELISA Kit
EHH0214	Abclonal	96Tests	EUR 521

Canine HBsAg Elisa Kit
ELA-E0940d	Lifescience Market	96 Tests	EUR 928

Goat HBsAg ELISA Kit
EGTH0214	Abclonal	96Tests	EUR 521

Bovine HBsAg ELISA Kit
EBH0214	Abclonal	96Tests	EUR 521

Canine HBsAg ELISA Kit
ECH0214	Abclonal	96Tests	EUR 521

Anserine HBsAg ELISA Kit
EAH0214	Abclonal	96Tests	EUR 521

HbsAg ELISA KIT|Human
EF007266	Lifescience Market	96 Tests	EUR 689

anti- HBsAg mouse antibody
HBV001	FN Test	100µg	EUR 548.75
Immunogen: HBsAg Research Area: Signal Transduction
Description: Antibody raised against HBsAg mouse

anti- HBsAg mouse antibody
HBV002	FN Test	100µg	EUR 548.75
Immunogen: HBsAg Research Area: Signal Transduction
Description: Antibody raised against HBsAg mouse

Porcine HBsAg ELISA Kit
EPH0214	Abclonal	96Tests	EUR 521

Rat HBsAg ELISA Kit
ERH0214	Abclonal	96Tests	EUR 521

Rabbit HBsAg ELISA Kit
ERTH0214	Abclonal	96Tests	EUR 521

Mouse HBsAg ELISA Kit
EMH0214	Abclonal	96Tests	EUR 521

HBV antigen HBsAg Antibody
abx140205-01mg	Abbexa	0.1 mg	EUR 328
Shipped within 5-12 working days.

HBV antigen HBsAg Antibody
abx140206-01mg	Abbexa	0.1 mg	EUR 328
Shipped within 5-12 working days.

Anti-HBsAg Antibody (1C10E2)
A1372-1000	Biovision		EUR 479

Anti-HBsAg Antibody (1G1A10)
A1373-1000	Biovision		EUR 479

Anti-HBsAg Antibody (3G9F6)
A1374-1000	Biovision		EUR 479

Anti-HBsAg (HBV) Purified
11-328-C025	ExBio	0.025 mg	EUR 90

Anti-HBsAg (HBV) Purified
11-328-C100	ExBio	0.1 mg	EUR 140

Anti-HBsAg (HBV) Purified
11-329-C025	ExBio	0.025 mg	EUR 90

Anti-HBsAg (HBV) Purified
11-329-C100	ExBio	0.1 mg	EUR 140

HBsAg protein (Subtype adr)
30C-CP2019R	Fitzgerald	1 mg	EUR 573
Description: Purified recombinant HBsAg protein (Subtype adr)

HBsAg protein (Subtype adw)
30R-AH016	Fitzgerald	500 ug	EUR 732
Description: Purified recombinant HBsAg protein (Subtype adw)

HBsAg protein (Subtype ayw)
30R-AH018	Fitzgerald	500 ug	EUR 761
Description: Purified recombinant HBsAg protein (Subtype ayw)

HBsAg protein (subtype ad)
30-1815	Fitzgerald	500 ug	EUR 435
Description: Native Human HBsAg protein (Subtype ad)

HBsAg protein (Subtype ay)
30-1816	Fitzgerald	500 ug	EUR 381
Description: Purified Native Human HBsAg protein (Subtype ay)

HBsAg protein (Subtype ad)
30-AH15	Fitzgerald	1 mg	EUR 348
Description: Purified native Human HBsAg protein (Subtype ad)

HBsAg protein (Subtype adr)
30-AH37	Fitzgerald	1 mg	EUR 705
Description: Purified recombinant HBsAg protein (Subtype adr) (98% pure)

HBsAg antibody (Gold Colloid)
62-H05B	Fitzgerald	10 ml	EUR 457
Description: Mouse monoclonal HBsAg antibody (Gold Colloid)

Human HBsAg ELISA Kit
DEIA001	Creative Diagnostics	96T	EUR 485
Description: 1. For screening of blood donors. 2. As an aid in the diagnosis of liver disease.

Control for HER2, 4 cases (1.5mm)
HRC081	Pantomics	1	EUR 85
Description: IHC control array containing 4 breast cancer cases of strong, moderate, low and negative HER2 breast cancer expressers in duplicates

Control for ER, 4 cases (1.5mm)
ERC081	Pantomics	1	EUR 85
Description: IHC control array containing 4 breast cancer cases of strong, moderate, weak/nil estrogen receptor (ER) expressers in duplicates

SLLK, Control Peptide for TSP1 Inhibitor
HY-P0301	MedChemExpress	1mg	EUR 133

Control for DOG1, 3 cases (1.5mm)
DOG1061	Pantomics	1	EUR 85
Description: IHC control array containing 3 GIST cases of strong, moderate, weak/nil DOG1 expressers in duplicates

Control for Ckit, 6 samples (1.5mm)
CKIT061	Pantomics	1	EUR 85
Description: Gastrointestinal stroma tumors, 6 cores, 3 cases in duplicates showing strong, moderate and no expression of cKit molecule.

Control for PR, 3 cases (1.5mm)
PRC061	Pantomics	1	EUR 85
Description: IHC control array containing 3 breast cancer cases of strong, moderate, low/negative progesterone receptor (PR) expressers in duplicates

PAS/Glycogen, For Digestion (Control Slides)
TCS0024-100	ScyTek Laboratories	100 Slides	EUR 706

PAS/Glycogen, For Digestion (Control Slides)
TCS0024-25	ScyTek Laboratories	25 Slides	EUR 232

PAS/Glycogen, For Digestion (Control Slides)
TCS0024-5	ScyTek Laboratories	5 Slides	EUR 98

Thiostatin Rat protein, control for western
TSTN11-C	Alpha Diagnostics	100 ul	EUR 286

Control/Blocking peptide for Human WNT5a
WNT511-P	Alpha Diagnostics	100 ug	EUR 164

Human IVD Antibody (Biotin Conjugate)
33170-05121	AssayPro	150 ug	EUR 369

IVD ORF Vector (Human) (pORF)
ORF005483	ABM	1.0 ug DNA	EUR 95

Ivd ORF Vector (Rat) (pORF)
ORF068825	ABM	1.0 ug DNA	EUR 506

Ivd ORF Vector (Mouse) (pORF)
ORF048200	ABM	1.0 ug DNA	EUR 506

ELISA kit for Canine hepatitis B virus surface antigen,HBsAg
EK0029	SAB	96 tests	EUR 830
Description: Enzyme-linked immunosorbent assay kit for quantification of Canine hepatitis B virus surface antigen,HBsAg in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human hepatitis B virus surface antigen,HBsAg
EK0216	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human hepatitis B virus surface antigen,HBsAg in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse hepatitis B virus surface antigen,HBsAg
EK0341	SAB	96 tests	EUR 830
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse hepatitis B virus surface antigen,HBsAg in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Hepatitis B surface antigen (HBsAg)  Kit
KTE63050-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Human Hepatitis B surface antigen (HBsAg)  Kit  in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Hepatitis B surface antigen (HBsAg)  Kit
KTE63050-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Hepatitis B surface antigen (HBsAg)  Kit  in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Hepatitis B surface antigen (HBsAg)  Kit
KTE63050-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Human Hepatitis B surface antigen (HBsAg)  Kit  in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Ferret IgG (Control, non-immune, isotype control), semi-pure for ELISA
20021-1	Alpha Diagnostics	100 ug	EUR 225