Mechanical Properties of Corner Joints Made of Honeycomb Panels with Double Arrow-Shaped

Genetic panorama of congenital problems in sufferers from Southeast Asia: outcomes from sequencing utilizing a gene panel for Mendelian phenotypes


Goal: To check the utility and diagnostic yield of a medical-exome gene panel for figuring out pathogenic variants in Mendelian problems.


Strategies: Subsequent-generation sequencing was carried out with the TruSight One gene panel (concentrating on 4813 genes) adopted by MiSeq sequencing on 216 sufferers who offered with suspected genetic problems as assessed by their attending physicians.


Outcomes: There have been 56 pathogenic and 36 possible pathogenic variants throughout 57 genes recognized in 87 sufferers. Causal mutations have been extra prone to be truncating and from sufferers with a previous scientific analysis. One other 18 promising variants want additional analysis for extra proof to fulfill the requirement for potential improve to pathogenic. Forty-five of the 92 clinically important variants have been novel.


Conclusion: The 40.3% optimistic yield compares favourably with related research utilizing both this panel or entire exome sequencing, demonstrating that giant gene panels may very well be a very good different to entire exome sequencing for fast genetic affirmation of Mendelian problems.

Frozen Tissue Section Panel - Monkey (Cynomolgus) Normal Tissue, Multi-tissue III
T6534423-Cy 5 slides
EUR 490
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Frozen Tissue Section Panel - Monkey (Rhesus) Normal Tissue, Multi-tissue I
T6534448 5 slides
EUR 490
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Frozen Tissue Section Panel - Monkey (Cynomolgus) Normal Tissue, Multi-tissue I
T6534448-Cy 5 slides
EUR 490
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Monkey (Cynomolgus) Normal Tissue, Multi-tissue III, 8 different tissues
T8534423-Cy 5 slides
EUR 261
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Monkey (Cynomolgus) Normal Tissue, Multi-tissue I, 8 different tissues
T8534448-Cy 5 slides
EUR 261
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Mouse Whole Brain Segmentation Panel
T8334035 5 slides
EUR 556
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Frozen Tissue Section Panel - Mouse Whole Brain Segmentation Panel
T6334035 5 slides
EUR 931
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Mouse Normal Tissue, Multi-tissue III
T8334423 5 slides
EUR 261
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Mouse Normal Tissue, Multi-tissue I
T8334447 5 slides
EUR 261
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Mouse Normal Tissue, Multi-tissue II
T8334608 5 slides
EUR 261
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Rat Normal Tissue, Multi-tissue III
T8434423 5 slides
EUR 261
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Rat Normal Tissue, Multi-tissue I
T8434448 5 slides
EUR 261
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Rat Normal Tissue, Multi-tissue II
T8434608 5 slides
EUR 261
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Frozen Tissue Section Panel - Mouse Normal Tissue, Multi-tissue III
T6334423 5 slides
EUR 490
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Frozen Tissue Section Panel - Mouse Normal Tissue, Multi-tissue I
T6334447 5 slides
EUR 490
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Frozen Tissue Section Panel - Mouse Normal Tissue, Multi-tissue II
T6334608 5 slides
EUR 490
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Frozen Tissue Section Panel - Rat Normal Tissue, Multi-tissue III
T6434423 5 slides
EUR 490
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Frozen Tissue Section Panel - Rat Normal Tissue, Multi-tissue I
T6434448 5 slides
EUR 490
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Frozen Tissue Section Panel - Human Adult Normal Tissue, Multi-tissue I
T6234431 5 slides
EUR 492
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Frozen Tissue Section Panel - Human Adult Normal Tissue, Multi-tissue II
T6234432 5 slides
EUR 492
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Frozen Tissue Section Panel - Human Adult Normal Tissue, Multi-tissue III
T6234433 5 slides
EUR 492
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Adult Normal Tissue, Multi-tissue (8) IV
T8234601 5 slides
EUR 261
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Adult Normal Tissue, Multi-tissue (8) V
T8234602 5 slides
EUR 261
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Adult Normal Tissue, Multi-tissue (8) VI
T8234603 5 slides
EUR 261
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Adult Normal Tissue, Multi-tissue (8) VII
T8234604 5 slides
EUR 261
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Adult Normal Tissue, Multi-tissue (8) VIII
T8234605 5 slides
EUR 249
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Adult Normal Tissue, Multi-tissue (8) IX
T8234606 5 slides
EUR 249
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Adult Normal Tissue, Multi-tissue (8) X
T8234607 5 slides
EUR 249
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Tumor, Different Tumor Type, Different Donors, Panel I, 5 tissue spots
T8235417 5 slides
EUR 367
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Tumor, Different Tumor Type, Different Donors, Panel II, 5 tissue spots
T8235418 5 slides
EUR 367
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Tumor, Different Tumor Type, Different Donors, Panel III, 5 tissue spots
T8235419 5 slides
EUR 367
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Tumor, Different Tumor Type, Different Donors, Panel IV, 5 tissue spots
T8235420 5 slides
EUR 367
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Tumor, Different Tumor Type, Different Donors, Panel V, 5 tissue spots
T8235421 5 slides
EUR 367
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Tumor, Different Tumor Type, Different Donors, Panel VI, 5 tissue spots
T8235422 5 slides
EUR 367
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Tumor, Different Tumor Type, Different Donors, Panel I, 8 tissue spots
T8235437 5 slides
EUR 543
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Tumor, Different Tumor Type, Different Donors, Panel II, 8 tissue spots
T8235438 5 slides
EUR 543
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Tumor, Different Tumor Type, Different Donors, Panel III, 8 tissue spots
T8235439 5 slides
EUR 543
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Tumor, Different Tumor Type, Different Donors, Panel IV, 8 tissue spots
T8235440 5 slides
EUR 543
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Tumor, Different Tumor Type, Different Donors, Panel V, 8 tissue spots
T8235441 5 slides
EUR 543
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Tumor, Different Tumor Type, Different Donors, Panel VI, 8 tissue spots
T8235442 5 slides
EUR 543
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Tumor, Different Tumor Type, Different Donors, Panel VII, 8 tissue spots
T8235443 5 slides
EUR 543
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Adult Normal Tissue, Multi-tissue (8) I: Major Organ
T8234431 5 slides
EUR 261
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Adult Normal Tissue, Multi-tissue (8) II: Major Organ
T8234432 5 slides
EUR 261
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Adult Normal Tissue, Multi-tissue (8) III: Major Organ
T8234433 5 slides
EUR 261
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Disease Tissue, Alzheimer's Disease, Multi-tissue I, 8 different tissues
T8236444Alz 5 slides
EUR 615
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Disease Tissue, Alzheimer's Disease, Multi-tissue II, 7 different tissues
T8236445Alz 5 slides
EUR 615
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Disease Tissue, Alzheimer's Disease, Multi-tissue III, 8 different tissues
T8236446Alz 5 slides
EUR 615
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Disease Tissue, Alzheimer's Disease, Multi-tissue IV, 7 different tissues
T8236564Alz 5 slides
EUR 615
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Frozen Tissue Section Panel - Human Disease Tissue, Alzheimer's Disease, Multi-tissue I, 7 different tissues
T6236444Alz 5 slides
EUR 1041
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Frozen Tissue Section Panel - Human Disease Tissue, Alzheimer's Disease, Multi-tissue II, 7 different tissues
T6236445Alz 5 slides
EUR 1041
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Frozen Tissue Section Panel - Human Disease Tissue, Alzheimer's Disease, Multi-tissue III, 8 different tissues
T6236446Alz 5 slides
EUR 1041
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Frozen Tissue Section Panel - Human Disease Tissue, Alzheimer's Disease, Multi-tissue IV, 7 different tissues
T6236564Alz 5 slides
EUR 1041
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Adult Normal Tissue, Brain I, 7 different tissues
T8234444 5 slides
EUR 261
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Adult Normal Tissue, Brain II, 7 different tissues
T8234445 5 slides
EUR 261
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Paraffin Tissue Section Panel - Human Adult Normal Tissue, Brain IV, 7 different tissues
T8234564 5 slides
EUR 261
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.
Monkey Cytoplasmic protein NCK1(NCK1) ELISA kit
E09C2359-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic protein NCK1(NCK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic protein NCK1(NCK1) ELISA kit
E09C2359-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic protein NCK1(NCK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic protein NCK1(NCK1) ELISA kit
E09C2359-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic protein NCK1(NCK1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic protein NCK2(NCK2) ELISA kit
E09C2360-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic protein NCK2(NCK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic protein NCK2(NCK2) ELISA kit
E09C2360-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic protein NCK2(NCK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic protein NCK2(NCK2) ELISA kit
E09C2360-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic protein NCK2(NCK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Actin, cytoplasmic 2 ELISA kit
E09A1220-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Actin, cytoplasmic 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Actin, cytoplasmic 2 ELISA kit
E09A1220-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Actin, cytoplasmic 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Actin, cytoplasmic 2 ELISA kit
E09A1220-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Actin, cytoplasmic 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic Linker Associated Protein 2 ELISA kit
E09C2555-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoplasmic Linker Associated Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic Linker Associated Protein 2 ELISA kit
E09C2555-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoplasmic Linker Associated Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic Linker Associated Protein 2 ELISA kit
E09C2555-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoplasmic Linker Associated Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Tissue Factor ELISA kit
E09T0037-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tissue Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Tissue Factor ELISA kit
E09T0037-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tissue Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Tissue Factor ELISA kit
E09T0037-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tissue Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Tissue Transglutaminase ELISA kit
E09T0766-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Tissue Transglutaminase ELISA kit
E09T0766-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Tissue Transglutaminase ELISA kit
E09T0766-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey (Rhesus) cDNA Tissue: Thyroid
MR34-265 10 rxn
EUR 415
Monkey Cytoplasmic tyrosine protein kinase BMX(BMX) ELISA kit
E09C1218-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic tyrosine protein kinase BMX(BMX) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic tyrosine protein kinase BMX(BMX) ELISA kit
E09C1218-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic tyrosine protein kinase BMX(BMX) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic tyrosine protein kinase BMX(BMX) ELISA kit
E09C1218-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic tyrosine protein kinase BMX(BMX) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic FMR1 interacting protein 1(CYFIP1) ELISA kit
E09C2216-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic FMR1 interacting protein 1(CYFIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic FMR1 interacting protein 1(CYFIP1) ELISA kit
E09C2216-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic FMR1 interacting protein 1(CYFIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic FMR1 interacting protein 1(CYFIP1) ELISA kit
E09C2216-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic FMR1 interacting protein 1(CYFIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic FMR1 interacting protein 2(CYFIP2) ELISA kit
E09C2217-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic FMR1 interacting protein 2(CYFIP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic FMR1 interacting protein 2(CYFIP2) ELISA kit
E09C2217-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic FMR1 interacting protein 2(CYFIP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic FMR1 interacting protein 2(CYFIP2) ELISA kit
E09C2217-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic FMR1 interacting protein 2(CYFIP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic phosphatidylinositol transfer protein 1(PITPNC1) ELISA kit
E09C2381-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic phosphatidylinositol transfer protein 1(PITPNC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic phosphatidylinositol transfer protein 1(PITPNC1) ELISA kit
E09C2381-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic phosphatidylinositol transfer protein 1(PITPNC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic phosphatidylinositol transfer protein 1(PITPNC1) ELISA kit
E09C2381-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic phosphatidylinositol transfer protein 1(PITPNC1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Anti-neutrophil cytoplasmic antibody ELISA kit
E09C0686-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Anti-neutrophil cytoplasmic antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Anti-neutrophil cytoplasmic antibody ELISA kit
E09C0686-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Anti-neutrophil cytoplasmic antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Anti-neutrophil cytoplasmic antibody ELISA kit
E09C0686-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Anti-neutrophil cytoplasmic antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Anti neutrophil cytoplasmic antibody ELISA kit
E09C0689-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anti neutrophil cytoplasmic antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Anti neutrophil cytoplasmic antibody ELISA kit
E09C0689-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anti neutrophil cytoplasmic antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Anti neutrophil cytoplasmic antibody ELISA kit
E09C0689-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Anti neutrophil cytoplasmic antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic aconitate hydase(ACO1) ELISA kit
E09C1180-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic aconitate hydase(ACO1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic aconitate hydase(ACO1) ELISA kit
E09C1180-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic aconitate hydase(ACO1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic aconitate hydase(ACO1) ELISA kit
E09C1180-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic aconitate hydase(ACO1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Malate dehydrogenase, cytoplasmic(MDH1) ELISA kit
E09M0390-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Malate dehydrogenase, cytoplasmic(MDH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Malate dehydrogenase, cytoplasmic(MDH1) ELISA kit
E09M0390-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Malate dehydrogenase, cytoplasmic(MDH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Malate dehydrogenase, cytoplasmic(MDH1) ELISA kit
E09M0390-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Malate dehydrogenase, cytoplasmic(MDH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Tissue Inhibitors Of Metalloproteinase 3 (TIMP3) Protein
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Membrane Protein from Monkey (Rhesus) Normal Tissue: Brain
P3534035 0.1 mg
EUR 285
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.
Membrane Protein from Monkey (Cynomolgus) Normal Tissue: Brain
P3534035-Cy 0.1 mg
EUR 285
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.
Membrane Protein from Monkey (Rhesus) Normal Tissue: Heart
P3534122 0.1 mg
EUR 285
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.
Monkey Tissue Polypeptide Antigen ELISA kit
E09T0013-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tissue Polypeptide Antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Tissue Polypeptide Antigen ELISA kit
E09T0013-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tissue Polypeptide Antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Tissue Polypeptide Antigen ELISA kit
E09T0013-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tissue Polypeptide Antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey tissue factor VII ELISA kit
E09T0131-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey tissue factor VII in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey tissue factor VII ELISA kit
E09T0131-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey tissue factor VII in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey tissue factor VII ELISA kit
E09T0131-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey tissue factor VII in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey tissue factor X ELISA kit
E09T0135-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey tissue factor X in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey tissue factor X ELISA kit
E09T0135-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey tissue factor X in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey tissue factor X ELISA kit
E09T0135-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey tissue factor X in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Transglutaminase 2,Tissue ELISA kit
E09T0764-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transglutaminase 2,Tissue in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Transglutaminase 2,Tissue ELISA kit
E09T0764-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transglutaminase 2,Tissue in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Transglutaminase 2,Tissue ELISA kit
E09T0764-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transglutaminase 2,Tissue in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey (Rhesus) Normal Adipose tissue lysate
MRL-1266 1 mg
EUR 773
Monkey (Cynomolgus) cDNA Normal Tissue: Liver
MC34-149 10 rxn
EUR 415
Monkey (Cynomolgus) cDNA Normal Tissue: Pancreas
MC34-188 10 rxn
EUR 415
Monkey (Cynomolgus) cDNA Normal Tissue: Spleen
MC34-246 10 rxn
EUR 415
Monkey (Cyno.) Normal Adipose tissue lysate
MCL-1159 1 mg
EUR 773
Monkey Cytoplasmic tRNA 2 thiolation protein 1(ATPBD3) ELISA kit
E09C1213-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic tRNA 2 thiolation protein 1(ATPBD3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic tRNA 2 thiolation protein 1(ATPBD3) ELISA kit
E09C1213-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic tRNA 2 thiolation protein 1(ATPBD3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic tRNA 2 thiolation protein 1(ATPBD3) ELISA kit
E09C1213-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cytoplasmic tRNA 2 thiolation protein 1(ATPBD3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic tRNA 2 thiolation protein 2(C16orf84) ELISA kit
E09C1224-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoplasmic tRNA 2 thiolation protein 2(C16orf84) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic tRNA 2 thiolation protein 2(C16orf84) ELISA kit
E09C1224-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoplasmic tRNA 2 thiolation protein 2(C16orf84) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic tRNA 2 thiolation protein 2(C16orf84) ELISA kit
E09C1224-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoplasmic tRNA 2 thiolation protein 2(C16orf84) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic polyadenylation element binding protein 1(CPEB1) ELISA kit
E09C1998-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoplasmic polyadenylation element binding protein 1(CPEB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic polyadenylation element binding protein 1(CPEB1) ELISA kit
E09C1998-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoplasmic polyadenylation element binding protein 1(CPEB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic polyadenylation element binding protein 1(CPEB1) ELISA kit
E09C1998-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoplasmic polyadenylation element binding protein 1(CPEB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic polyadenylation element binding protein 2(CPEB2) ELISA kit
E09C1999-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoplasmic polyadenylation element binding protein 2(CPEB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic polyadenylation element binding protein 2(CPEB2) ELISA kit
E09C1999-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoplasmic polyadenylation element binding protein 2(CPEB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic polyadenylation element binding protein 2(CPEB2) ELISA kit
E09C1999-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoplasmic polyadenylation element binding protein 2(CPEB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic polyadenylation element binding protein 3(CPEB3) ELISA kit
E09C2000-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoplasmic polyadenylation element binding protein 3(CPEB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic polyadenylation element binding protein 3(CPEB3) ELISA kit
E09C2000-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoplasmic polyadenylation element binding protein 3(CPEB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic polyadenylation element binding protein 3(CPEB3) ELISA kit
E09C2000-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoplasmic polyadenylation element binding protein 3(CPEB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic polyadenylation element binding protein 4(CPEB4) ELISA kit
E09C2001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoplasmic polyadenylation element binding protein 4(CPEB4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic polyadenylation element binding protein 4(CPEB4) ELISA kit
E09C2001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoplasmic polyadenylation element binding protein 4(CPEB4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytoplasmic polyadenylation element binding protein 4(CPEB4) ELISA kit
E09C2001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytoplasmic polyadenylation element binding protein 4(CPEB4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Aspartyl tRNA synthetase, cytoplasmic(DARS) ELISA kit
E09A1822-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Aspartyl tRNA synthetase, cytoplasmic(DARS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Aspartyl tRNA synthetase, cytoplasmic(DARS) ELISA kit
E09A1822-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Aspartyl tRNA synthetase, cytoplasmic(DARS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Aspartyl tRNA synthetase, cytoplasmic(DARS) ELISA kit
E09A1822-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Aspartyl tRNA synthetase, cytoplasmic(DARS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Asparaginyl tRNA synthetase, cytoplasmic(NARS) ELISA kit
E09A1927-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Asparaginyl tRNA synthetase, cytoplasmic(NARS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Asparaginyl tRNA synthetase, cytoplasmic(NARS) ELISA kit
E09A1927-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Asparaginyl tRNA synthetase, cytoplasmic(NARS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Asparaginyl tRNA synthetase, cytoplasmic(NARS) ELISA kit
E09A1927-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Asparaginyl tRNA synthetase, cytoplasmic(NARS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Arginyl tRNA synthetase, cytoplasmic(RARS) ELISA kit
E09A1076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Arginyl tRNA synthetase, cytoplasmic(RARS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Arginyl tRNA synthetase, cytoplasmic(RARS) ELISA kit
E09A1076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Arginyl tRNA synthetase, cytoplasmic(RARS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Arginyl tRNA synthetase, cytoplasmic(RARS) ELISA kit
E09A1076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Arginyl tRNA synthetase, cytoplasmic(RARS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Alanyl tRNA synthetase, cytoplasmic(AARS) ELISA kit
E09A1121-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Alanyl tRNA synthetase, cytoplasmic(AARS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Alanyl tRNA synthetase, cytoplasmic(AARS) ELISA kit
E09A1121-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Alanyl tRNA synthetase, cytoplasmic(AARS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Alanyl tRNA synthetase, cytoplasmic(AARS) ELISA kit
E09A1121-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Alanyl tRNA synthetase, cytoplasmic(AARS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cysteinyl tRNA synthetase, cytoplasmic(CARS) ELISA kit
E09C1384-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cysteinyl tRNA synthetase, cytoplasmic(CARS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cysteinyl tRNA synthetase, cytoplasmic(CARS) ELISA kit
E09C1384-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cysteinyl tRNA synthetase, cytoplasmic(CARS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cysteinyl tRNA synthetase, cytoplasmic(CARS) ELISA kit
E09C1384-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cysteinyl tRNA synthetase, cytoplasmic(CARS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Proteinase 3 antineutrophil cytoplasmic antibody ELISA kit
E09P0712-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Proteinase 3 antineutrophil cytoplasmic antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Proteinase 3 antineutrophil cytoplasmic antibody ELISA kit
E09P0712-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Proteinase 3 antineutrophil cytoplasmic antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Proteinase 3 antineutrophil cytoplasmic antibody ELISA kit
E09P0712-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Proteinase 3 antineutrophil cytoplasmic antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Tyrosyl tRNA synthetase, cytoplasmic(YARS) ELISA kit
E09T0747-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tyrosyl tRNA synthetase, cytoplasmic(YARS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Tyrosyl tRNA synthetase, cytoplasmic(YARS) ELISA kit
E09T0747-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tyrosyl tRNA synthetase, cytoplasmic(YARS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Tyrosyl tRNA synthetase, cytoplasmic(YARS) ELISA kit
E09T0747-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tyrosyl tRNA synthetase, cytoplasmic(YARS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Perinuclear anti neutrophil cytoplasmic antibody ELISA kit
E09P0602-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Perinuclear anti neutrophil cytoplasmic antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Perinuclear anti neutrophil cytoplasmic antibody ELISA kit
E09P0602-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Perinuclear anti neutrophil cytoplasmic antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Affiliation between Main Healthcare and Medical Expenditures in a Context of Hospital-Oriented Healthcare System in China: A Nationwide Panel Dataset, 2012-2016


Complete well being expenditure in China has grown significantly since a brand new spherical of well being system reform was enacted in 2009. Researchers have proven that strengthening main healthcare could also be an possibility for nations to resolve the speedy growth of their medical expenditures. This research was designed to discover the affiliation between the power of main healthcare and medical expenditures, within the context of the hospital-oriented healthcare system in China.

A longitudinal ecological research was carried out utilizing a 5-year panel dataset of 27 provinces in mainland China. The linear blended results regression mannequin was used to evaluate the results of main healthcare-related metrics on medical expenditures, controlling for the provincial degree specialty care doctor provide and socio-economic parameters.

All the three main healthcare-related metrics confirmed unfavorable associations with the 2 medical expenditure parameters. Main care physicians per 10,000 inhabitants was considerably related to the per capita hospital medical expenditures (p < 0.05), and the share of public well being expenditure in whole well being expenditure was considerably related to each per capita whole medical expenditure and per capita hospital medical expenditures (p < 0.01 for each).

Our research discovered unfavorable associations between the first healthcare capability and medical expenditure within the context of hospital-oriented healthcare techniques in China, including to the earlier proof that main healthcare might play a optimistic function in lowering medical expenditure. Insurance policies on rising the first care doctor provide and the general public share of whole well being expenditure must be carried out to strengthen the first healthcare system. With the gradual advance of medical reform and the coverage inclination to main healthcare, this can play a extra essential function in controlling the speedy development of medical expenditure.

Mechanical Properties of Nook Joints Product of Honeycomb Panels with Double Arrow-Formed Auxetic Cores

The event of each mild and powerful wood-derived supplies is an fascinating analysis space, notably when it comes to usability in, e.g., furnishings constructions. Honeycomb panels being present business customary are comparatively thick (32 mm and 40 mm), thus their attractiveness in designing furnishings is restricted.

In just a few research, it has been proven that honeycomb panels with paper cores are characterised by unsatisfactory mechanical properties, particularly when the composite thickness is lower than 20 mm. From the literature, it’s also evident that mechanical properties is perhaps improved by introducing auxetic options into the core construction.

Regardless that it’s a idea with nice potential, there are just a few research coping with honeycomb panels with auxetic cores fabricated from paper. Moreover, there’s no analysis on the nook joints constructed from such materials. Because of this, the goal of the research was to check the bending habits of the nook adhesive joints fabricated from honeycomb panels with double arrow-shaped auxetic cores.

Throughout the analysis, the core cell was adopted primarily based on literature and preliminary research, paper auxetic cores have been produced by means of the designed and 3d printed gadget, and joints stiffness and power have been calculated analytically primarily based on the experiment outcomes.

Evaluated nook joints stiffness, each in compression and pressure check, is bigger for samples fabricated from panels with designed auxetic cores. Surprisingly, within the analyzed vary of elasticity, it was statistically proved that the values of joint stiffness coefficient Ok didn’t differ considerably between in contrast joints pairs.

Bovine Lumpy skin disease virus (LSDV) control for western blot

LSDV11-C 100 ul
EUR 286

ELISA kit for Human Autoimmune regulator

EK3200 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Autoimmune regulator in samples from serum, plasma, tissue homogenates and other biological fluids.

Ivd/ Rat Ivd ELISA Kit

ELI-39421r 96 Tests
EUR 886

Paraffin Tissue Section Panel - Human Disease Tissue, Alzheimer's Disease, Multi-tissue I, 8 different tissues

T8236444Alz 5 slides
EUR 615
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Paraffin Tissue Section Panel - Human Disease Tissue, Alzheimer's Disease, Multi-tissue II, 7 different tissues

T8236445Alz 5 slides
EUR 615
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Paraffin Tissue Section Panel - Human Disease Tissue, Alzheimer's Disease, Multi-tissue III, 8 different tissues

T8236446Alz 5 slides
EUR 615
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Paraffin Tissue Section Panel - Human Disease Tissue, Alzheimer's Disease, Multi-tissue IV, 7 different tissues

T8236564Alz 5 slides
EUR 615
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Frozen Tissue Section Panel - Human Disease Tissue, Alzheimer's Disease, Multi-tissue I, 7 different tissues

T6236444Alz 5 slides
EUR 1041
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Frozen Tissue Section Panel - Human Disease Tissue, Alzheimer's Disease, Multi-tissue II, 7 different tissues

T6236445Alz 5 slides
EUR 1041
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Frozen Tissue Section Panel - Human Disease Tissue, Alzheimer's Disease, Multi-tissue III, 8 different tissues

T6236446Alz 5 slides
EUR 1041
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Frozen Tissue Section Panel - Human Disease Tissue, Alzheimer's Disease, Multi-tissue IV, 7 different tissues

T6236564Alz 5 slides
EUR 1041
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IVD antibody

22140-100ul 100ul
EUR 390

IVD antibody

10R-4491 100 ul
EUR 691
Description: Mouse monoclonal IVD antibody

IVD antibody

70R-18039 50 ul
EUR 435
Description: Rabbit polyclonal IVD antibody

IVD antibody

70R-13603 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal IVD antibody

IVD Antibody

DF12284 200ul
EUR 304
Description: IVD antibody detects endogenous levels of IVD.

IVD Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

IVD Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000


YF-PA12811 50 ug
EUR 363
Description: Mouse polyclonal to IVD


YF-PA12812 100 ug
EUR 403
Description: Rabbit polyclonal to IVD

ELISA kit for Human AIRE (Autoimmune Regulator)

ELK3194 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Autoimmune Regulator (AIRE). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Autoim
  • Show more
Description: A sandwich ELISA kit for detection of Autoimmune Regulator from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse AIRE (Autoimmune Regulator)

ELK6262 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Autoimmune Regulator (AIRE). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Autoim
  • Show more
Description: A sandwich ELISA kit for detection of Autoimmune Regulator from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

CLIA kit for Human AIRE (Autoimmune Regulator)

E-CL-H0428 1 plate of 96 wells
EUR 584
  • Gentaur's AIRE CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human AIRE . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human AIRE (Autoimmune Regulator) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human AIRE (Autoimmune Regulator)

E-EL-H0536 1 plate of 96 wells
EUR 534
  • Gentaur's AIRE ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human AIRE. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human AIRE (Autoimmune Regulator) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Autoimmune regulator (AIRE)

KTE60636-48T 48T
EUR 332
  • The Autoimmune Regulator is expressed in the thymus. It causes transcription of a wide selection of organ-specific genes. This reduces the threat of autoimmunity occurring by allowing the elimination of autoreactive T cells by the process of negative
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Autoimmune regulator (AIRE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Autoimmune regulator (AIRE)

KTE60636-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The Autoimmune Regulator is expressed in the thymus. It causes transcription of a wide selection of organ-specific genes. This reduces the threat of autoimmunity occurring by allowing the elimination of autoreactive T cells by the process of negative
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Autoimmune regulator (AIRE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Autoimmune regulator (AIRE)

KTE60636-96T 96T
EUR 539
  • The Autoimmune Regulator is expressed in the thymus. It causes transcription of a wide selection of organ-specific genes. This reduces the threat of autoimmunity occurring by allowing the elimination of autoreactive T cells by the process of negative
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Autoimmune regulator (AIRE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Autoimmune regulator (AIRE)

KTE70434-48T 48T
EUR 332
  • The Autoimmune Regulator is expressed in the thymus. It causes transcription of a wide selection of organ-specific genes. This reduces the threat of autoimmunity occurring by allowing the elimination of autoreactive T cells by the process of negative
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Autoimmune regulator (AIRE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Autoimmune regulator (AIRE)

KTE70434-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The Autoimmune Regulator is expressed in the thymus. It causes transcription of a wide selection of organ-specific genes. This reduces the threat of autoimmunity occurring by allowing the elimination of autoreactive T cells by the process of negative
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Autoimmune regulator (AIRE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Autoimmune regulator (AIRE)

KTE70434-96T 96T
EUR 539
  • The Autoimmune Regulator is expressed in the thymus. It causes transcription of a wide selection of organ-specific genes. This reduces the threat of autoimmunity occurring by allowing the elimination of autoreactive T cells by the process of negative
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Autoimmune regulator (AIRE) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Autoimmune regulator Antibody

48041-100ul 100ul
EUR 333

Autoimmune regulator Antibody

48041-50ul 50ul
EUR 239

Rabbit control serum (non-immunized, Disease free, SPF Rabbits)

NSPF-1 1 ml
EUR 286

Rabbit control serum (non-immunized, Disease free, SPF Rabbits)

NSPF-10 10 ml
EUR 651

Rabbit control serum (non-immunized, Disease free, SPF Rabbits)

NSPF-5 5 ml
EUR 529

IVD cloning plasmid

CSB-CL011921HU-10ug 10ug
EUR 465
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1272
  • Sequence: atggcgactgcgactcggctgctggggtgtcgtgtggcgagctggaggctgcggccgccgcttgccggcttcgtttcccagcgggcccactcgcttttgcccgtggacgatgcaatcaatgggctaagcgaggagcagaggcagcttcgtcagaccatggctaagttccttcagg
  • Show more
Description: A cloning plasmid for the IVD gene.

anti- IVD antibody

FNab04426 100µg
EUR 505.25
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

anti- IVD antibody

FNab04427 100µg
EUR 585
  • Recommended dilution: WB: 1:1000-1:6000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

IVD Rabbit pAb

A15281-100ul 100 ul
EUR 308

IVD Rabbit pAb

A15281-200ul 200 ul
EUR 459

IVD Rabbit pAb

A15281-20ul 20 ul
EUR 183

IVD Rabbit pAb

A15281-50ul 50 ul
EUR 223

Human IVD Antibody

33170-05111 150 ug
EUR 261

IVD Polyclonal Antibody

28898-100ul 100ul
EUR 252

IVD Polyclonal Antibody

28898-50ul 50ul
EUR 187

IVD Blocking Peptide

DF12284-BP 1mg
EUR 195

Anti-IVD antibody

PAab04426 100 ug
EUR 355

Anti-IVD antibody

STJ117476 100 µl
EUR 277
Description: Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

IVD, Human Recombinant

P1577-100 100 µg
EUR 510

IVD, Human Recombinant

P1577-20 20 µg
EUR 156

Bovine Anti-Lumpy skin disease virus (LSDV) negative control serum

RV-500700-01N 1 ml
EUR 164

Bovine Anti-Lumpy skin disease virus (LSDV) positive control serum

RV-500700-02P 1 ml
EUR 225

Foot and mouth disease virus serotype O, 3D (FMDO-3D) protein control for western blot

FMDO3D11-C 100 ul
EUR 347

ELISA kit for Mouse Experimental autoimmune prostatitis antigen 2

EK4826 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Experimental autoimmune prostatitis antigen 2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Autoimmune Regulator (AIRE) Antibody

abx117155-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody

abx038141-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody

abx019018-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Autoimmune Regulator (AIRE) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Autoimmune Regulator (AIRE) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Autoimmune Regulator (AIRE) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody

abx331461-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Autoimmune Regulator (AIRE) Antibody

abx230241-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Autoimmune Regulator (AIRE) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Autoimmune regulator (AIRE) Antibody

48129-100ul 100ul
EUR 333

Autoimmune regulator (AIRE) Antibody

48129-50ul 50ul
EUR 239

Autoimmune regulator (AIRE) Antibody

48149-100ul 100ul
EUR 333

Autoimmune regulator (AIRE) Antibody

48149-50ul 50ul
EUR 239

ELISA kit for Human PLA2G4D (Phospholipase A2, Group IVD)

ELK6188 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phospholipase A2, Group IVD (PLA2G4D). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Phospholipase A2, Group IVD from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Recombinant Foot and mouth disease virus serotype O, 2B (FMDO-2B) protein control for western blot

FMDO2B11-C 100 ul
EUR 286

Recombinant Foot and mouth disease virus serotype O, 2C (FMDO-2C) protein control for western blot

FMDO2C11-C 100 ul
EUR 286

Recombinant Foot and mouth disease virus serotype O, 3AB (FMDO-3AB) protein control for western blot

FMDO3AB11-C 100 ul
EUR 286

Goat IgG (-ve control for flow cytometry) (isotype control)

20011-100 100 test
EUR 103

Mouse polycystic kidney and hepatic disease 1 (PKHD1) Control/blocking peptide

AB-23227-P 100ug
EUR 164

IVD Polyclonal Conjugated Antibody

C28898 100ul
EUR 397

Mouse IVD shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat IVD shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-12848h 96 Tests
EUR 824


ELI-13527b 96 Tests
EUR 928


EF010406 96 Tests
EUR 689


ELI-43520m 96 Tests
EUR 865

IVD protein (His tag)

80R-1262 100 ug
EUR 268
Description: Purified recombinant Human IVD protein