ZFP91 Rabbit Polyclonal Antibody

ZFP91 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

ZFP91 Polyclonal Antibody

ABP57548-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic peptide from human protein at AA range: 401-450
  • Applications tips:
Description: A polyclonal antibody for detection of ZFP91 from Human, Mouse, Rat. This ZFP91 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 401-450

ZFP91 Polyclonal Antibody

ABP57548-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 401-450
  • Applications tips:
Description: A polyclonal antibody for detection of ZFP91 from Human, Mouse, Rat. This ZFP91 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 401-450

ZFP91 Polyclonal Antibody

ABP57548-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 401-450
  • Applications tips:
Description: A polyclonal antibody for detection of ZFP91 from Human, Mouse, Rat. This ZFP91 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 401-450

ZFP91 antibody

70R-8108 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ZFP91 antibody

ZFP91 Antibody

42873-100ul 100ul
EUR 252

ZFP91 antibody

20R-1105 100 ug
EUR 377
Description: Rabbit polyclonal ZFP91 antibody

ZFP91 antibody

20R-1106 100 ug
EUR 377
Description: Rabbit polyclonal ZFP91 antibody

ZFP91 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against ZFP91. Recognizes ZFP91 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000

ZFP91 Zinc Finger Protein (ZFP91) Antibody

abx122288-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ZFP91 Zinc Finger Protein (ZFP91) Antibody

abx027075-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ZFP91 Zinc Finger Protein (ZFP91) Antibody

abx027075-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ZFP91 Zinc Finger Protein (ZFP91) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ZFP91 Zinc Finger Protein (ZFP91) Antibody

abx224439-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase ZFP91 (ZFP91) Antibody

abx224324-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

ZFP91 Conjugated Antibody

C42873 100ul
EUR 397

Anti-ZFP91 Antibody

A11088 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ZFP91 Antibody (ZFP91) detection. Tested with WB in Human, Mouse, Rat.

Anti-ZFP91 antibody

STJ98654 200 µl
EUR 197
Description: Rabbit polyclonal to ZFP91.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ZFP91 Blocking Peptide

33R-7291 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZFP91 antibody, catalog no. 20R-1105

ZFP91 Blocking Peptide

33R-7842 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZFP91 antibody, catalog no. 20R-1106

ZFP91 cloning plasmid

CSB-CL842694HU-10ug 10ug
EUR 588
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1710
  • Sequence: atgccgggggagacggaagagccgagacccccggagcagcaggaccaggaagggggagaggcggccaaggcggctccggaggagccccaacaacggccccctgaggcgatcgcggcggcgcctgcagggaccactagcagccgcgtgctgaggggaggtcgggaccgaggccggg
  • Show more
Description: A cloning plasmid for the ZFP91 gene.

Human E3 ubiquitin- protein ligase ZFP91, ZFP91 ELISA KIT

ELI-17992h 96 Tests
EUR 824

Mouse E3 ubiquitin- protein ligase ZFP91, Zfp91 ELISA KIT

ELI-14759m 96 Tests
EUR 865

Mouse ZFP91 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ZFP91 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ZFP91 Recombinant Protein (Human)

RP035392 100 ug Ask for price

ZFP91 Recombinant Protein (Rat)

RP238625 100 ug Ask for price

ZFP91 Recombinant Protein (Mouse)

RP187841 100 ug Ask for price

Zfp91 ORF Vector (Rat) (pORF)

ORF079543 1.0 ug DNA
EUR 506

ZFP91 ORF Vector (Human) (pORF)

ORF011798 1.0 ug DNA
EUR 95

Zfp91 ORF Vector (Mouse) (pORF)

ORF062615 1.0 ug DNA
EUR 506

ZFP91-CNTF Recombinant Protein (Human)

RP108392 100 ug Ask for price

ZFP91 sgRNA CRISPR Lentivector set (Human)

K2674301 3 x 1.0 ug
EUR 339

Zfp91 sgRNA CRISPR Lentivector set (Mouse)

K4013301 3 x 1.0 ug
EUR 339

Zfp91 sgRNA CRISPR Lentivector set (Rat)

K7323601 3 x 1.0 ug
EUR 339

ZFP91-CNTF ORF Vector (Human) (pORF)

ORF036132 1.0 ug DNA Ask for price

ZFP91 sgRNA CRISPR Lentivector (Human) (Target 1)

K2674302 1.0 ug DNA
EUR 154

ZFP91 sgRNA CRISPR Lentivector (Human) (Target 2)

K2674303 1.0 ug DNA
EUR 154

ZFP91 sgRNA CRISPR Lentivector (Human) (Target 3)

K2674304 1.0 ug DNA
EUR 154

Zfp91 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4013302 1.0 ug DNA
EUR 154

Zfp91 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4013303 1.0 ug DNA
EUR 154

Zfp91 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4013304 1.0 ug DNA
EUR 154

Zfp91 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7323602 1.0 ug DNA
EUR 154

Zfp91 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7323603 1.0 ug DNA
EUR 154

Zfp91 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7323604 1.0 ug DNA
EUR 154

Recombinant human E3 ubiquitin-protein ligase ZFP91

P2644 100ug Ask for price
  • Uniprot ID: Q96JP5
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human E3 ubiquitin-protein ligase ZFP91

ZFP91 Protein Vector (Human) (pPB-C-His)

PV047189 500 ng
EUR 329

ZFP91 Protein Vector (Human) (pPB-N-His)

PV047190 500 ng
EUR 329

ZFP91 Protein Vector (Human) (pPM-C-HA)

PV047191 500 ng
EUR 329

ZFP91 Protein Vector (Human) (pPM-C-His)

PV047192 500 ng
EUR 329

ZFP91 Protein Vector (Rat) (pPB-C-His)

PV318170 500 ng
EUR 603

ZFP91 Protein Vector (Rat) (pPB-N-His)

PV318171 500 ng
EUR 603

ZFP91 Protein Vector (Rat) (pPM-C-HA)

PV318172 500 ng
EUR 603

ZFP91 Protein Vector (Rat) (pPM-C-His)

PV318173 500 ng
EUR 603

ZFP91 Protein Vector (Mouse) (pPB-C-His)

PV250458 500 ng
EUR 603

ZFP91 Protein Vector (Mouse) (pPB-N-His)

PV250459 500 ng
EUR 603

ZFP91 Protein Vector (Mouse) (pPM-C-HA)

PV250460 500 ng
EUR 603

ZFP91 Protein Vector (Mouse) (pPM-C-His)

PV250461 500 ng
EUR 603

Zfp91 3'UTR Luciferase Stable Cell Line

TU122907 1.0 ml Ask for price

Zfp91 3'UTR GFP Stable Cell Line

TU172907 1.0 ml Ask for price

ZFP91 3'UTR GFP Stable Cell Line

TU078852 1.0 ml
EUR 2333

ZFP91 3'UTR Luciferase Stable Cell Line

TU028852 1.0 ml
EUR 2333

Zfp91 3'UTR Luciferase Stable Cell Line

TU223844 1.0 ml Ask for price

Zfp91 3'UTR GFP Stable Cell Line

TU273844 1.0 ml Ask for price

ZFP91 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV632953 1.0 ug DNA
EUR 682

ZFP91 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV632957 1.0 ug DNA
EUR 682

ZFP91 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV632958 1.0 ug DNA
EUR 682

ZFP91-CNTF Protein Vector (Human) (pPB-C-His)

PV144526 500 ng Ask for price

ZFP91-CNTF Protein Vector (Human) (pPB-N-His)

PV144527 500 ng Ask for price

ZFP91-CNTF Protein Vector (Human) (pPM-C-HA)

PV144528 500 ng Ask for price

ZFP91-CNTF Protein Vector (Human) (pPM-C-His)

PV144529 500 ng Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ZFP91 Rabbit Polyclonal Antibody