WIPI1 Rabbit Polyclonal Antibody

WIPI1 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

WIPI1 Polyclonal Antibody

ABP57486-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide of WIPI1
  • Applications tips:
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1

WIPI1 Polyclonal Antibody

ABP57486-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide of WIPI1
  • Applications tips:
Description: A polyclonal antibody for detection of WIPI1 from Human, Mouse. This WIPI1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide of WIPI1

WIPI1 Polyclonal Antibody

30955-100ul 100ul
EUR 252

WIPI1 Polyclonal Antibody

30955-50ul 50ul
EUR 187

WIPI1 Rabbit pAb

A7528-100ul 100 ul
EUR 308

WIPI1 Rabbit pAb

A7528-200ul 200 ul
EUR 459

WIPI1 Rabbit pAb

A7528-20ul 20 ul
EUR 183

WIPI1 Rabbit pAb

A7528-50ul 50 ul
EUR 223

Polyclonal WIPI1 Antibody (Center)

APR10749G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WIPI1 (Center). This antibody is tested and proven to work in the following applications:

WIPI1 Polyclonal Conjugated Antibody

C30955 100ul
EUR 397

WIPI1 antibody

70R-4358 50 ug
EUR 467
Description: Rabbit polyclonal WIPI1 antibody raised against the N terminal of WIPI1

WIPI1 antibody

70R-4359 50 ug
EUR 467
Description: Rabbit polyclonal WIPI1 antibody raised against the middle region of WIPI1

WIPI1 Antibody

1-CSB-PA705810ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against WIPI1. Recognizes WIPI1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

Polyclonal WIPI1 Antibody (N-term)

APR10751G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WIPI1 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal ATG18 / WIPI1 Antibody (C-Terminus)

APG02035G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG18 / WIPI1 (C-Terminus). This antibody is tested and proven to work in the following applications:

anti- WIPI1 antibody

FNab09512 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: WD repeat domain, phosphoinositide interacting 1
  • Uniprot ID: Q5MNZ9
  • Gene ID: 55062
  • Research Area: Metabolism
Description: Antibody raised against WIPI1

Anti-WIPI1 antibody

PAab09512 100 ug
EUR 412

Anti-WIPI1 antibody

STJ98592 200 µl
EUR 197
Description: Rabbit polyclonal to WIPI1.

Anti-WIPI1 antibody

STJ29666 100 µl
EUR 277
Description: This gene encodes a WD40 repeat protein. Members of the WD40 repeat family are key components of many essential biologic functions. They regulate the assembly of multiprotein complexes by presenting a beta-propeller platform for simultaneous and reversible protein-protein interactions. Members of the WIPI subfamily of WD40 repeat proteins have a 7-bladed propeller structure and contain a conserved motif for interaction with phospholipids. Alternative splicing results in multiple transcript variants.

WIPI1 siRNA

20-abx939857
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WIPI1 siRNA

20-abx939858
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WIPI1 Blocking Peptide

33R-5144 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of WIPI1 antibody, catalog no. 70R-4359

WIPI1 Blocking Peptide

33R-1237 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TTMB antibody, catalog no. 70R-6812

WIPI1 cloning plasmid

CSB-CL705810HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1341
  • Sequence: atggaggccgaggccgcggacgctcccccgggcggggttgagtcggcgctcagctgcttctctttcaaccaggactgcacatccctagcaattggaactaaagccgggtataagctgttttctctgagttctgtggagcagctggatcaagtccacggaagcaatgaaatcccgg
  • Show more
Description: A cloning plasmid for the WIPI1 gene.

Anti-WIPI1 (3C1)

YF-MA18725 100 ug
EUR 363
Description: Mouse monoclonal to WIPI1

WIPI1 Rabbit Polyclonal Antibody