TMPO Rabbit Polyclonal Antibody

TMPO Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

TMPO Polyclonal Antibody
ES8548-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TMPO from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
TMPO Polyclonal Antibody
ABP57555-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic peptide from human protein at AA range: 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50
TMPO Polyclonal Antibody
ABP57555-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50
TMPO Polyclonal Antibody
ABP57555-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50
TMPO Polyclonal Antibody
46756-100ul 100ul
EUR 252
TMPO Polyclonal Antibody
46756-50ul 50ul
EUR 187
TMPO / TMPO Antibody
20-abx329779
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
TMPO/TMPO Antibody
1-CSB-PA259190
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against TMPO/TMPO. Recognizes TMPO/TMPO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000
TMPO antibody
70R-20884 50 ul
EUR 435
Description: Rabbit polyclonal TMPO antibody
TMPO Antibody
ABD6994 100 ug
EUR 438
TMPO Antibody
32699-100ul 100ul
EUR 252
TMPO Antibody
DF6994 200ul
EUR 304
Description: TMPO Antibody detects endogenous levels of total TMPO.
TMPO Antibody
1-CSB-PA023913GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TMPO. Recognizes TMPO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse)
4-PAC824Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO)
[KO Validated] TMPO Rabbit pAb
A2534-100ul 100 ul
EUR 410
[KO Validated] TMPO Rabbit pAb
A2534-200ul 200 ul
EUR 571
[KO Validated] TMPO Rabbit pAb
A2534-20ul 20 ul
EUR 221
[KO Validated] TMPO Rabbit pAb
A2534-50ul 50 ul
EUR 287
TMPO Conjugated Antibody
C32699 100ul
EUR 397
Thymopoietin (TMPO) Antibody
20-abx116091
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thymopoietin (TMPO) Antibody
20-abx131651
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Thymopoietin (TMPO) Antibody
20-abx001974
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thymopoietin (TMPO) Antibody
20-abx142268
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thymopoietin (TMPO) Antibody
abx030767-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Thymopoietin (TMPO) Antibody
abx030767-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Thymopoietin (TMPO) Antibody
abx028266-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Thymopoietin (TMPO) Antibody
abx028266-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Thymopoietin (TMPO) Antibody
20-abx174779
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Anti-TMPO antibody
STJ98661 200 µl
EUR 197
Description: TMPO is a protein encoded by the TMPO gene which is approximately 75,4 kDa. TMPO is localised to the nucleus and is involved in the mitotic cell cycle, nuclear envelope reassembly, transport of the SLBP independent mature mRNA and apoptosis. It may be involved in the structural organization of the nucleus and in the post-mitotic nuclear assembly and plays an important role, together with LMNA, in the nuclear anchorage of RB1. It may also be involved in the control of initiation of DNA replication through its interaction with NAKAP95. TMPO is expressed in many tissues and is most abundant in adult thymus and fetal liver. Mutations in the TMPO gene result in dilated cardiomyopathy and dysentery. STJ98661 was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen. This antibody detects endogenous TMPO protein.
Anti-TMPO antibody
STJ25881 100 µl
EUR 413
Description: The protein encoded by this gene resides in the nucleus and may play a role in the assembly of the nuclear lamina, and thus help maintain the structural organization of the nuclear envelope. It may function as a receptor for the attachment of lamin filaments to the inner nuclear membrane. Mutations in this gene are associated with dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.
Polyclonal TMPO / TP / Thymopoietin Antibody (N-Terminus)
APR03096G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMPO / TP / Thymopoietin (N-Terminus). This antibody is tested and proven to work in the following applications:
Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), APC
4-PAC824Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with APC.
Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAC824Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with Biotin.
Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), Cy3
4-PAC824Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with Cy3.
Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), FITC
4-PAC824Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with FITC.
Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), HRP
4-PAC824Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with HRP.
Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), PE
4-PAC824Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with PE.
TMPO siRNA
20-abx900018
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TMPO siRNA
20-abx900039
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TMPO siRNA
20-abx937501
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TMPO siRNA
20-abx937502
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TMPO siRNA
20-abx937503
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-TMPO
YF-PA27383 50 ug
EUR 363
Description: Mouse polyclonal to TMPO
Anti-TMPO/Lap2 Antibody
A03278 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for TMPO Antibody (TMPO) detection.tested for IHC, WB in Human, Mouse, Rat.
Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAC824Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TMPO (Met1~Leu243)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with APC-Cy7.
TMPO cloning plasmid
CSB-CL023913HU-10ug 10ug
EUR 492
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1365
  • Sequence: atgccggagttcctggaagacccctcggtcctgacaaaagacaagttgaagagtgagttggtcgccaacaatgtgacgctgccggccggggagcagcgcaaagacgtgtacgtccagctctacctgcagcacctcacggctcgcaaccggccgccgctccccgccggcaccaaca
  • Show more
Description: A cloning plasmid for the TMPO gene.
TMPO Blocking Peptide
DF6994-BP 1mg
EUR 195
Recombinant Thymopoietin (TMPO)
4-RPC824Hu01
  • EUR 445.86
  • EUR 222.00
  • EUR 1396.96
  • EUR 532.32
  • EUR 964.64
  • EUR 361.00
  • EUR 3342.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P42167
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Thymopoietin expressed in: E.coli
Human Thymopoietin (TMPO) Protein
20-abx650199
  • EUR 620.00
  • EUR 272.00
  • EUR 1887.00
  • EUR 746.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Rat TMPO shRNA Plasmid
20-abx984957
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse Tmpo ELISA KIT
ELI-04131m 96 Tests
EUR 865
Human TMPO ELISA KIT
ELI-04132h 96 Tests
EUR 824
Mouse Tmpo ELISA KIT
ELI-04134m 96 Tests
EUR 865
Human TMPO shRNA Plasmid
20-abx954879
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TMPO shRNA Plasmid
20-abx954880
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TMPO shRNA Plasmid
20-abx973144
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TMPO shRNA Plasmid
20-abx973145
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TMPO Recombinant Protein (Human)
RP032329 100 ug Ask for price
TMPO Recombinant Protein (Rat)
RP233936 100 ug Ask for price
TMPO Recombinant Protein (Mouse)
RP180017 100 ug Ask for price
TMPO Recombinant Protein (Mouse)
RP180020 100 ug Ask for price
TMPO Recombinant Protein (Mouse)
RP180023 100 ug Ask for price
TMPO Recombinant Protein (Mouse)
RP180026 100 ug Ask for price
TMPO Recombinant Protein (Mouse)
RP180029 100 ug Ask for price
TMPO Recombinant Protein (Mouse)
RP180032 100 ug Ask for price
Human Thymopoietin (TMPO) ELISA Kit
abx516008-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Thymopoietin (TMPO) ELISA Kit
abx516010-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Thymopoietin (TMPO) ELISA Kit
abx516012-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Thymopoietin(TMPO)ELISA kit
GA-E0838MS-48T 48T
EUR 336
Mouse Thymopoietin(TMPO)ELISA kit
GA-E0838MS-96T 96T
EUR 534
Human Thymopoietin (TMPO) ELISA Kit
20-abx153290
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Thymopoietin (TMPO) CLIA Kit
20-abx493916
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Thymopoietin (TMPO)ELISA kit
201-12-2287 96 tests
EUR 440
  • This Thymopoietin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Tmpo ORF Vector (Mouse) (pORF)
ORF060007 1.0 ug DNA
EUR 506
Tmpo ORF Vector (Mouse) (pORF)
ORF060008 1.0 ug DNA
EUR 506
Tmpo ORF Vector (Mouse) (pORF)
ORF060009 1.0 ug DNA
EUR 506
Tmpo ORF Vector (Mouse) (pORF)
ORF060010 1.0 ug DNA
EUR 506
Tmpo ORF Vector (Mouse) (pORF)
ORF060011 1.0 ug DNA
EUR 506
Tmpo ORF Vector (Mouse) (pORF)
ORF060012 1.0 ug DNA
EUR 506
Tmpo ORF Vector (Rat) (pORF)
ORF077980 1.0 ug DNA
EUR 506
TMPO ORF Vector (Human) (pORF)
ORF010777 1.0 ug DNA
EUR 95
Human Thymopoietin (TMPO) ELISA Kit
SEC824Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.
Human Thymopoietin (TMPO) ELISA Kit
SEC824Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.
Human Thymopoietin (TMPO) ELISA Kit
SEC824Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.
Human Thymopoietin (TMPO) ELISA Kit
SEC824Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.
Human Thymopoietin (TMPO) ELISA Kit
4-SEC824Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thymopoietin elisa. Alternative names of the recognized antigen: TP
  • LAP2
  • CMD1T
  • LEMD4
  • TP5
  • Splenin
  • Lamina-Associated Polypeptide 2, Isoforms Beta/Gamma
  • LEM Domain Containing 4
  • Thymopoietin-related peptide isoforms beta/gamma
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thymopoietin (TMPO) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Thymopoietin ELISA Kit (TMPO)
RK02407 96 Tests
EUR 521
Human Thymopoietin(TMPO)ELISA Kit
QY-E00760 96T
EUR 361
Rat Thymopoietin(TMPO)ELISA kit
QY-E10460 96T
EUR 361
Mouse Thymopoietin(TMPO)ELISA kit
QY-E21460 96T
EUR 361
pECMV-Tmpo-m-FLAG Plasmid
PVT14942 2 ug
EUR 325
TMPO ELISA Kit (Human) (OKCD02937)
OKCD02937 96 Wells
EUR 831
Description: Description of target: May help direct the assembly of the nuclear lamina and thereby help maintain the structural organization of the nuclear envelope. Possible receptor for attachment of lamin filaments to the inner nuclear membrane. May be involved in the control of initiation of DNA replication through its interaction with NAKAP95. Thymopoietin (TP) and Thymopentin (TP5) may play a role in T-cell development and function. TP5 is an immunomodulating pentapeptide. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12.9 pg/mL
TMPO ELISA Kit (Rat) (OKEH03323)
OKEH03323 96 Wells
EUR 662
Description: Description of target: Binds directly to lamin B1 and chromosomes in a mitotic phosphorylation-regulated manner. May play an important role in nuclear envelope reassembly at the end of mitosis and/or anchoring of the nuclear lamina and interphase chromosomes to the nuclear envelope.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.4 ng/mL
TMPO ELISA Kit (Human) (OKEI00289)
OKEI00289 96 Wells
EUR 767
Description: Description of target: May be involved in the structural organization of the nucleus and in the post-mitotic nuclear assembly. Plays an important role, together with LMNA, in the nuclear anchorage of RB1. TP and TP5 may play a role in T-cell development and function. TP5 is an immunomodulating pentapeptide. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.938 ng/mL

TMPO Rabbit Polyclonal Antibody