TLR4 Rabbit Polyclonal Antibody

TLR4 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

Polyclonal TLR4 Antibody
APG03000G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR4 . This antibody is tested and proven to work in the following applications:
Polyclonal TLR4 Antibody
APG03001G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR4 . This antibody is tested and proven to work in the following applications:
TLR4 Polyclonal Antibody
EA180-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR4 from Human/ Rat/ Mouse. This antibody is tested and validated for IHC
TLR4 Polyclonal Antibody
EA180-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR4 from Human/ Rat/ Mouse. This antibody is tested and validated for IHC
TLR4 Polyclonal Antibody
ES8209-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR4 from Human/Mouse/Rat. This antibody is tested and validated for IHC
TLR4 Polyclonal Antibody
ES8209-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR4 from Human/Mouse/Rat. This antibody is tested and validated for IHC
TLR4 Polyclonal Antibody
ABP57210-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR4 from Human, Mouse, Rat. This TLR4 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
TLR4 Polyclonal Antibody
ABP57210-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR4 from Human, Mouse, Rat. This TLR4 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
TLR4 Polyclonal Antibody
ABP57210-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR4 from Human, Mouse, Rat. This TLR4 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
TLR4 Rabbit pAb
A0007-100ul 100 ul
EUR 308
TLR4 Rabbit pAb
A0007-200ul 200 ul
EUR 459
TLR4 Rabbit pAb
A0007-20ul 20 ul
EUR 183
TLR4 Rabbit pAb
A0007-50ul 50 ul
EUR 223
TLR4 Rabbit pAb
A11226-100ul 100 ul
EUR 308
TLR4 Rabbit pAb
A11226-200ul 200 ul
EUR 459
TLR4 Rabbit pAb
A11226-20ul 20 ul
EUR 183
TLR4 Rabbit pAb
A11226-50ul 50 ul
EUR 223
TLR4 Rabbit pAb
A5258-100ul 100 ul
EUR 308
TLR4 Rabbit pAb
A5258-200ul 200 ul
EUR 459
TLR4 Rabbit pAb
A5258-20ul 20 ul
EUR 183
TLR4 Rabbit pAb
A5258-50ul 50 ul
EUR 223
TLR4 Rabbit pAb
A17436-100ul 100 ul
EUR 308
TLR4 Rabbit pAb
A17436-200ul 200 ul
EUR 459
TLR4 Rabbit pAb
A17436-20ul 20 ul
EUR 183
TLR4 Rabbit pAb
A17436-50ul 50 ul
EUR 223
TLR4 Rabbit pAb
A2464-100ul 100 ul
EUR 308
TLR4 Rabbit pAb
A2464-200ul 200 ul
EUR 459
TLR4 Rabbit pAb
A2464-20ul 20 ul Ask for price
TLR4 Rabbit pAb
A2464-50ul 50 ul Ask for price
Polyclonal TLR4 Antibody (Internal)
APR11220G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR4 (Internal). This antibody is tested and proven to work in the following applications:
Polyclonal TLR4 Antibody (Center)
AMM05418G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR4 (Center). This antibody is tested and proven to work in the following applications:
TLR4 Polyclonal Conjugated Antibody
C40697 100ul
EUR 397
Bovine Toll Like Receptor 4 (TLR4) ELISA Kit
DLR-TLR4-b-48T 48T
EUR 547
  • Should the Bovine Toll Like Receptor 4 (TLR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Toll Like Receptor 4 (TLR4) in samples from serum, plasma, tissue homogenates or other biological fluids.
Bovine Toll Like Receptor 4 (TLR4) ELISA Kit
DLR-TLR4-b-96T 96T
EUR 715
  • Should the Bovine Toll Like Receptor 4 (TLR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Toll Like Receptor 4 (TLR4) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Toll Like Receptor 4 (TLR4) ELISA Kit
DLR-TLR4-Hu-48T 48T
EUR 479
  • Should the Human Toll Like Receptor 4 (TLR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 4 (TLR4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Toll Like Receptor 4 (TLR4) ELISA Kit
DLR-TLR4-Hu-96T 96T
EUR 621
  • Should the Human Toll Like Receptor 4 (TLR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 4 (TLR4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Toll Like Receptor 4 (TLR4) ELISA Kit
DLR-TLR4-Mu-48T 48T
EUR 489
  • Should the Mouse Toll Like Receptor 4 (TLR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Toll Like Receptor 4 (TLR4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Toll Like Receptor 4 (TLR4) ELISA Kit
DLR-TLR4-Mu-96T 96T
EUR 635
  • Should the Mouse Toll Like Receptor 4 (TLR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Toll Like Receptor 4 (TLR4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Toll Like Receptor 4 (TLR4) ELISA Kit
DLR-TLR4-Ra-48T 48T
EUR 508
  • Should the Rat Toll Like Receptor 4 (TLR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Toll Like Receptor 4 (TLR4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Toll Like Receptor 4 (TLR4) ELISA Kit
DLR-TLR4-Ra-96T 96T
EUR 661
  • Should the Rat Toll Like Receptor 4 (TLR4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Toll Like Receptor 4 (TLR4) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Bovine Toll Like Receptor 4 (TLR4) ELISA Kit
RDR-TLR4-b-48Tests 48 Tests
EUR 580
Bovine Toll Like Receptor 4 (TLR4) ELISA Kit
RDR-TLR4-b-96Tests 96 Tests
EUR 807
Human Toll Like Receptor 4 (TLR4) ELISA Kit
RDR-TLR4-Hu-48Tests 48 Tests
EUR 500
Human Toll Like Receptor 4 (TLR4) ELISA Kit
RDR-TLR4-Hu-96Tests 96 Tests
EUR 692
Mouse Toll Like Receptor 4 (TLR4) ELISA Kit
RDR-TLR4-Mu-48Tests 48 Tests
EUR 511
Mouse Toll Like Receptor 4 (TLR4) ELISA Kit
RDR-TLR4-Mu-96Tests 96 Tests
EUR 709
Rat Toll Like Receptor 4 (TLR4) ELISA Kit
RDR-TLR4-Ra-48Tests 48 Tests
EUR 534
Rat Toll Like Receptor 4 (TLR4) ELISA Kit
RDR-TLR4-Ra-96Tests 96 Tests
EUR 742
Bovine Toll Like Receptor 4 (TLR4) ELISA Kit
RD-TLR4-b-48Tests 48 Tests
EUR 555
Bovine Toll Like Receptor 4 (TLR4) ELISA Kit
RD-TLR4-b-96Tests 96 Tests
EUR 771
Human Toll Like Receptor 4 (TLR4) ELISA Kit
RD-TLR4-Hu-48Tests 48 Tests
EUR 478
Human Toll Like Receptor 4 (TLR4) ELISA Kit
RD-TLR4-Hu-96Tests 96 Tests
EUR 662
Mouse Toll Like Receptor 4 (TLR4) ELISA Kit
RD-TLR4-Mu-48Tests 48 Tests
EUR 489
Mouse Toll Like Receptor 4 (TLR4) ELISA Kit
RD-TLR4-Mu-96Tests 96 Tests
EUR 677
Rat Toll Like Receptor 4 (TLR4) ELISA Kit
RD-TLR4-Ra-48Tests 48 Tests
EUR 511
Rat Toll Like Receptor 4 (TLR4) ELISA Kit
RD-TLR4-Ra-96Tests 96 Tests
EUR 709
Polyclonal TLR4 Antibody (aa650-700)
APR11217G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR4 (aa650-700). This antibody is tested and proven to work in the following applications:
Polyclonal TLR4 Antibody (C-Terminus)
APR11218G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR4 (C-Terminus). This antibody is tested and proven to work in the following applications:
CD284 / TLR4(TLR4/230) Antibody
BNC610230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF660R conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC610230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF660R conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC680230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF568 conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC680230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF568 conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC430230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF543 conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC430230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF543 conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC550230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF555 conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC550230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF555 conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC040230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF405S conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC040230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF405S conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC400230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF640R conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC400230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF640R conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC050230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF405M conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC050230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF405M conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC470230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF647 conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC470230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF647 conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNUM0230-50 50uL
EUR 395
Description: Primary antibody against CD284 / TLR4(TLR4/230), 1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC700230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF770 conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC700230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF770 conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC940230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF594 conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC940230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF594 conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNCH0230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNCH0230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC800230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF680 conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC800230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF680 conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC810230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF680R conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC810230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF680R conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNCP0230-250 250uL
EUR 383
Description: Primary antibody against CD284 / TLR4(TLR4/230), PerCP conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNCR0230-250 250uL
EUR 383
Description: Primary antibody against CD284 / TLR4(TLR4/230), RPE conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNCA0230-250 250uL
EUR 383
Description: Primary antibody against CD284 / TLR4(TLR4/230), APC conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNCAP0230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNCAP0230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNCB0230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), Biotin conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNCB0230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), Biotin conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC880230-100 100uL
EUR 199
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF488A conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNC880230-500 500uL
EUR 544
Description: Primary antibody against CD284 / TLR4(TLR4/230), CF488A conjugate, Concentration: 0.1mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNUB0230-100 100uL
EUR 209
Description: Primary antibody against CD284 / TLR4(TLR4/230), Concentration: 0.2mg/mL
CD284 / TLR4(TLR4/230) Antibody
BNUB0230-500 500uL
EUR 458
Description: Primary antibody against CD284 / TLR4(TLR4/230), Concentration: 0.2mg/mL
Rabbit TLR4 ELISA Kit
ERTT0076 96Tests
EUR 521
TLR4 Antibody
AF7017 200ul
EUR 376
Description: TLR4 antibody detects endogenous levels of total TLR4.
TLR4 antibody
ABF7017 100 ug
EUR 438
TLR4 antibody
70R-20849 50 ul
EUR 435
Description: Rabbit polyclonal TLR4 antibody
TLR4 antibody
70R-9659 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TLR4 antibody
TLR4 antibody
70R-9688 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TLR4 antibody
TLR4 Antibody
35463-100ul 100ul
EUR 390
TLR4 Antibody
35577-100ul 100ul
EUR 252
TLR4 Antibody
3251-100
EUR 338
TLR4 Antibody
3253-100
EUR 327
TLR4 Antibody
3253-30T
EUR 146
TLR4 Antibody
24193-100ul 100ul
EUR 390
TLR4 Antibody
24194-100ul 100ul
EUR 390
TLR4 antibody
20R-1503 100 ug
EUR 673
Description: Rabbit polyclonal TLR4 antibody
TLR4 antibody
20R-1505 100 ug
EUR 673
Description: Rabbit polyclonal TLR4 antibody
TLR4 antibody
70R-14023 100 ug
EUR 305
Description: Affinity purified Rabbit polyclonal TLR4 antibody
TLR4 antibody
70R-11717 100 ug
EUR 436
Description: Rabbit polyclonal TLR4 antibody
TLR4 antibody
70R-11719 100 ug
EUR 418
Description: Rabbit polyclonal TLR4 antibody
TLR4 Antibody
1-CSB-PA902590
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR4. Recognizes TLR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
TLR4 Antibody
1-CSB-PA001434
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TLR4. Recognizes TLR4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000
TLR4 Antibody
1-CSB-PA776633
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR4. Recognizes TLR4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200
TLR4 Antibody
1-CSB-PA585936
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR4. Recognizes TLR4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200
TLR4 Antibody
1-CSB-PA237733
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR4. Recognizes TLR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
TLR4 Antibody
1-CSB-PA080181
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TLR4. Recognizes TLR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1:200-500.ELISA:1/10000
TLR4 Antibody
1-CSB-PA023603GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TLR4. Recognizes TLR4 from Human, Mouse, Rat, Bovin. This antibody is Unconjugated. Tested in the following application: ELISA, WB
TLR4 antibody
PAab09837 100 ug
EUR 386
Polyclonal M TLR4 Antibody (N-term)
APR10938G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human M TLR4 (N-term). This antibody is tested and proven to work in the following applications:
TLR4 Conjugated Antibody
C35577 100ul
EUR 397
anti- TLR4 antibody
FNab09837 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:8000
  • IHC: 1:50-1:500
  • Immunogen: toll-like receptor 4
  • Uniprot ID: O00206
  • Gene ID: 7099
  • Research Area: Neuroscience, Immunology, Signal Transduction, Developmental biology
Description: Antibody raised against TLR4
anti- TLR4 antibody
FNab08727 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:100 - 1:200
  • Immunogen: toll-like receptor 4
  • Uniprot ID: O00206
  • Gene ID: 7099
  • Research Area: Neuroscience, Immunology, Signal Transduction, Developmental biology
Description: Antibody raised against TLR4
Anti-TLR4 antibody
PAab08727 100 ug
EUR 355
Anti-TLR4 Antibody
PA1484 100ug/vial
EUR 334
Anti-TLR4 Antibody
STJ503278 100 µg
EUR 476
Anti-TLR4 antibody
STJ97404 200 µl
EUR 197
Description: Rabbit polyclonal to TLR4.
Anti-TLR4 antibody
STJ29910 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. Mutations in this gene have been associated with differences in LPS responsiveness. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-TLR4 antibody
STJ110884 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. Mutations in this gene have been associated with differences in LPS responsiveness. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-TLR4 antibody
STJ25867 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. Mutations in this gene have been associated with differences in LPS responsiveness. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-TLR4 antibody
STJ113740 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. Mutations in this gene have been associated with differences in LPS responsiveness. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-TLR4 antibody
STJ119553 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. Mutations in this gene have been associated with differences in LPS responsiveness. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-TLR4 antibody
STJ16100496 1 mL
EUR 604
Anti-TLR4 antibody
STJ16100497 0.5 ml
EUR 478
TLR4 siRNA
20-abx905595
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TLR4/CD284
GT15235 100 ug
EUR 526
TLR4 siRNA
20-abx936895
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TLR4 siRNA
20-abx936896
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TLR4 Plasmid
PVT7122 2 ug
EUR 266
anti-TLR4
YF-PA24856 50 ul
EUR 334
Description: Mouse polyclonal to TLR4
Phospho-TLR4(Ser800) Antibody
AF7455 200ul
EUR 376
Description: Phospho-TLR4( Ser800) Antibody detects endogenous levels of TLR4.
Anti-TLR4 / CD284 antibody
STJ73641 100 µg
EUR 359
Anti-TLR4 Antibody (Biotin)
STJ503299 100 µg
EUR 586
Anti-TLR4 Antibody (FITC)
STJ503300 100 µg
EUR 586
Antibody for Human TLR4
SPC-200D 0.1mg
EUR 322
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is unconjugated.
Antibody for Human TLR4
SPC-200D-A390 0.1mg
EUR 369
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to ATTO 390.
Antibody for Human TLR4
SPC-200D-A488 0.1mg
EUR 368
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to ATTO 488.
Antibody for Human TLR4
SPC-200D-A565 0.1mg
EUR 368
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to ATTO 565.
Antibody for Human TLR4
SPC-200D-A594 0.1mg
EUR 368
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to ATTO 594.
Antibody for Human TLR4
SPC-200D-A633 0.1mg
EUR 368
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to ATTO 633.
Antibody for Human TLR4
SPC-200D-A655 0.1mg
EUR 368
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to ATTO 655.
Antibody for Human TLR4
SPC-200D-A680 0.1mg
EUR 368
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to ATTO 680.
Antibody for Human TLR4
SPC-200D-A700 0.1mg
EUR 368
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to ATTO 700.
Antibody for Human TLR4
SPC-200D-ALP 0.1mg
EUR 362
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to Alkaline Phosphatase.
Antibody for Human TLR4
SPC-200D-APC 0.1mg
EUR 367
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to APC .
Antibody for Human TLR4
SPC-200D-APCCY7 0.1mg
EUR 440
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to APC/Cy7.
Antibody for Human TLR4
SPC-200D-BI 0.1mg
EUR 364
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to Biotin.
Antibody for Human TLR4
SPC-200D-DY350 0.1mg
EUR 383
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to Dylight 350.
Antibody for Human TLR4
SPC-200D-DY405 0.1mg
EUR 371
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to Dylight 405.
Antibody for Human TLR4
SPC-200D-DY488 0.1mg
EUR 361
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to Dylight 488.
Antibody for Human TLR4
SPC-200D-DY594 0.1mg
EUR 363
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to Dylight 594.
Antibody for Human TLR4
SPC-200D-DY633 0.1mg
EUR 359
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to Dylight 633.
Antibody for Human TLR4
SPC-200D-FITC 0.1mg
EUR 360
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to FITC.
Antibody for Human TLR4
SPC-200D-HRP 0.1mg
EUR 357
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to HRP.
Antibody for Human TLR4
SPC-200D-P594 0.1mg
EUR 375
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to PE/ATTO 594.
Antibody for Human TLR4
SPC-200D-PCP 0.1mg
EUR 367
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to PerCP.
Antibody for Human TLR4
SPC-200D-RPE 0.1mg
EUR 365
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to RPE .
Antibody for Human TLR4
SPC-200D-STR 0.1mg
EUR 366
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is conjugated to Streptavidin.
Antibody for Human TLR4
SPC-200S 0.012mg
EUR 65
  • The Toll-like receptor (TLR) family in mammal comprises a family of trans-membrane proteins characterized by multiple copies of leucine rich repeats in the extracellular domain and 1L-1 receptor motif in the cytoplasmic domain. Like its counterparts
  • Show more
Description: A polyclonal antibody for TLR4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human Developed against a synthetic peptide corresponding to amino acids 420-435 of human TLR4. The Antibody is tested and validated for WB, IHC, ICC/IF, FCM, FACS assays with the following recommended dilutions: WB (1:500), IHC (1:50). This TLR4 antibody is unconjugated.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Human)
4-PAA753Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (Phe326~Ile634)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 4 (TLR4)
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Mouse)
4-PAA753Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (Asn26~Glu269)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 4 (TLR4)
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Rat)
4-PAA753Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (His49~Gln247)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 4 (TLR4)
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Human), APC
4-PAA753Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (Phe326~Ile634)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 4 (TLR4). This antibody is labeled with APC.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Human), Biotinylated
4-PAA753Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (Phe326~Ile634)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 4 (TLR4). This antibody is labeled with Biotin.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Human), Cy3
4-PAA753Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (Phe326~Ile634)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 4 (TLR4). This antibody is labeled with Cy3.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Human), FITC
4-PAA753Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (Phe326~Ile634)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 4 (TLR4). This antibody is labeled with FITC.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Human), HRP
4-PAA753Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (Phe326~Ile634)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 4 (TLR4). This antibody is labeled with HRP.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Human), PE
4-PAA753Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (Phe326~Ile634)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 4 (TLR4). This antibody is labeled with PE.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Mouse), APC
4-PAA753Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (Asn26~Glu269)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 4 (TLR4). This antibody is labeled with APC.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Mouse), Biotinylated
4-PAA753Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (Asn26~Glu269)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 4 (TLR4). This antibody is labeled with Biotin.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Mouse), Cy3
4-PAA753Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (Asn26~Glu269)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 4 (TLR4). This antibody is labeled with Cy3.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Mouse), FITC
4-PAA753Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (Asn26~Glu269)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 4 (TLR4). This antibody is labeled with FITC.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Mouse), HRP
4-PAA753Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (Asn26~Glu269)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 4 (TLR4). This antibody is labeled with HRP.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Mouse), PE
4-PAA753Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (Asn26~Glu269)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 4 (TLR4). This antibody is labeled with PE.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Rat), APC
4-PAA753Ra01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (His49~Gln247)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 4 (TLR4). This antibody is labeled with APC.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Rat), Biotinylated
4-PAA753Ra01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (His49~Gln247)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 4 (TLR4). This antibody is labeled with Biotin.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Rat), Cy3
4-PAA753Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (His49~Gln247)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 4 (TLR4). This antibody is labeled with Cy3.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Rat), FITC
4-PAA753Ra01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (His49~Gln247)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 4 (TLR4). This antibody is labeled with FITC.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Rat), HRP
4-PAA753Ra01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (His49~Gln247)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 4 (TLR4). This antibody is labeled with HRP.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Rat), PE
4-PAA753Ra01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (His49~Gln247)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 4 (TLR4). This antibody is labeled with PE.
Anti-Mouse-TLR4/MD2 antibody
STJ16100494 1 mL
EUR 604
Anti-Mouse-TLR4/MD2 antibody
STJ16100495 0.5 ml
EUR 478
TLR4 Blocking Peptide
AF7017-BP 1mg
EUR 195
TLR4 cloning plasmid
CSB-CL023603HU-10ug 10ug
EUR 815
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2520
  • Sequence: atgatgtctgcctcgcgcctggctgggactctgatcccagccatggccttcctctcctgcgtgagaccagaaagctgggagccctgcgtggaggtggttcctaatattacttatcaatgcatggagctgaatttctacaaaatccccgacaacctccccttctcaaccaagaacc
  • Show more
Description: A cloning plasmid for the TLR4 gene.
TLR4 Blocking Peptide
33R-4969 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLR4 antibody, catalog no. 70R-9659
TLR4 Blocking Peptide
33R-10686 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLR4 antibody, catalog no. 70R-11719
TLR4 Blocking Peptide
3253BP-50
EUR 153
Recombinant human TLR4
P2006 100ug Ask for price
  • Uniprot ID: O00206
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human TLR4
pcDNA3-TLR4-YFP
PVT14486 2 ug
EUR 599
Anti-TLR4 (1H7)
YF-MA15891 200 ul
EUR 363
Description: Mouse monoclonal to TLR4
Anti-TLR4 (4B10)
YF-MA15894 100 ug
EUR 363
Description: Mouse monoclonal to TLR4
Anti-TLR4 (3G12)
YF-MA15895 100 ug
EUR 363
Description: Mouse monoclonal to TLR4
Anti-TLR4 (3B6)
YF-MA10943 100 ug
EUR 363
Description: Mouse monoclonal to TLR4
Anti-TLR4 (1H7)
YF-MA10944 100 ug
EUR 363
Description: Mouse monoclonal to TLR4
Rabbit Toll-like receptor 4 (TLR4)ELISA Kit
QY-E30012 96T
EUR 374
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Human), APC-Cy7
4-PAA753Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (Phe326~Ile634)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 4 (TLR4). This antibody is labeled with APC-Cy7.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA753Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (Asn26~Glu269)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 4 (TLR4). This antibody is labeled with APC-Cy7.
Toll Like Receptor 4 (TLR4) Polyclonal Antibody (Rat), APC-Cy7
4-PAA753Ra01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR4 (His49~Gln247)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 4 (TLR4). This antibody is labeled with APC-Cy7.
Toll-Like Receptor 4 (TLR4) Antibody
20-abx124092
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Toll-Like Receptor 4 (TLR4) Antibody
20-abx126710
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Toll-Like Receptor 4 (TLR4) Antibody
20-abx116124
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Toll-Like Receptor 4 (TLR4) Antibody
20-abx001921
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Toll Like Receptor 4 (TLR4) Antibody
20-abx132308
  • EUR 314.00
  • EUR 787.00
  • EUR 411.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
Toll Like Receptor 4 (TLR4) Antibody
20-abx102067
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Toll Like Receptor 4 (TLR4) Antibody
20-abx102068
  • EUR 300.00
  • EUR 133.00
  • EUR 773.00
  • EUR 411.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Toll Like Receptor 4 (TLR4) Antibody
20-abx102069
  • EUR 300.00
  • EUR 133.00
  • EUR 801.00
  • EUR 425.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Toll-Like Receptor 4 (TLR4) Antibody
abx034472-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Toll-Like Receptor 4 (TLR4) Antibody
abx034472-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Toll-Like Receptor 4 (TLR4) Antibody
20-abx007226
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Toll Like Receptor 4 (TLR4) Antibody
20-abx174841
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Toll Like Receptor 4 (TLR4) Antibody
20-abx174842
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

TLR4 Rabbit Polyclonal Antibody