TLR2 Rabbit Polyclonal Antibody

TLR2 Rabbit Polyclonal Antibody

To Order Now:

Polyclonal TLR2 Antibody
APG02993G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR2 . This antibody is tested and proven to work in the following applications:
TLR2 Polyclonal Antibody
EA184-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR2 from Human/ Rat/ Mouse. This antibody is tested and validated for IHC
TLR2 Polyclonal Antibody
EA184-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR2 from Human/ Rat/ Mouse. This antibody is tested and validated for IHC
Polyclonal TLR2 Antibody
APR11210G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR2 . This antibody is tested and proven to work in the following applications:
TLR2 Polyclonal Antibody
A54840 100 µg
EUR 570.55
Description: fast delivery possible
TLR2 Polyclonal Antibody
ABP57214-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR2 from Human, Mouse, Rat. This TLR2 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
TLR2 Polyclonal Antibody
ABP57214-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR2 from Human, Mouse, Rat. This TLR2 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
TLR2 Polyclonal Antibody
ABP57214-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TLR2 from Human, Mouse, Rat. This TLR2 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
TLR2 Polyclonal Antibody
ES8213-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TLR2 from Human/Mouse/Rat. This antibody is tested and validated for IHC
TLR2 Polyclonal Antibody
ES8213-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TLR2 from Human/Mouse/Rat. This antibody is tested and validated for IHC
TLR2 Rabbit pAb
A11225-100ul 100 ul
EUR 308
TLR2 Rabbit pAb
A11225-200ul 200 ul
EUR 459
TLR2 Rabbit pAb
A11225-20ul 20 ul
EUR 183
TLR2 Rabbit pAb
A11225-50ul 50 ul
EUR 223
TLR2 Rabbit pAb
A0367-100ul 100 ul
EUR 459
TLR2 Rabbit pAb
A0367-200ul 200 ul
EUR 686
TLR2 Rabbit pAb
A0367-20ul 20 ul
EUR 183
TLR2 Rabbit pAb
A0367-50ul 50 ul
EUR 308
TLR2 Rabbit pAb
A2545-100ul 100 ul
EUR 308
TLR2 Rabbit pAb
A2545-200ul 200 ul
EUR 459
TLR2 Rabbit pAb
A2545-20ul 20 ul
EUR 183
TLR2 Rabbit pAb
A2545-50ul 50 ul
EUR 223
Human Toll Like Receptor 2 (TLR2) ELISA Kit
DLR-TLR2-Hu-48T 48T
EUR 479
  • Should the Human Toll Like Receptor 2 (TLR2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 2 (TLR2) in samples from serum, plasma, tissue homogenates, cell lysates, saliva, cell culture supernates or other biological fluids.
Human Toll Like Receptor 2 (TLR2) ELISA Kit
DLR-TLR2-Hu-96T 96T
EUR 621
  • Should the Human Toll Like Receptor 2 (TLR2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Toll Like Receptor 2 (TLR2) in samples from serum, plasma, tissue homogenates, cell lysates, saliva, cell culture supernates or other biological fluids.
Mouse Toll Like Receptor 2 (TLR2) ELISA Kit
DLR-TLR2-Mu-48T 48T
EUR 489
  • Should the Mouse Toll Like Receptor 2 (TLR2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Toll Like Receptor 2 (TLR2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Toll Like Receptor 2 (TLR2) ELISA Kit
DLR-TLR2-Mu-96T 96T
EUR 635
  • Should the Mouse Toll Like Receptor 2 (TLR2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Toll Like Receptor 2 (TLR2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Toll Like Receptor 2 (TLR2) ELISA Kit
DLR-TLR2-Ra-48T 48T
EUR 508
  • Should the Rat Toll Like Receptor 2 (TLR2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Toll Like Receptor 2 (TLR2) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat Toll Like Receptor 2 (TLR2) ELISA Kit
DLR-TLR2-Ra-96T 96T
EUR 661
  • Should the Rat Toll Like Receptor 2 (TLR2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Toll Like Receptor 2 (TLR2) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Toll Like Receptor 2 (TLR2) ELISA Kit
RDR-TLR2-Hu-48Tests 48 Tests
EUR 500
Human Toll Like Receptor 2 (TLR2) ELISA Kit
RDR-TLR2-Hu-96Tests 96 Tests
EUR 692
Mouse Toll Like Receptor 2 (TLR2) ELISA Kit
RDR-TLR2-Mu-48Tests 48 Tests
EUR 511
Mouse Toll Like Receptor 2 (TLR2) ELISA Kit
RDR-TLR2-Mu-96Tests 96 Tests
EUR 709
Rat Toll Like Receptor 2 (TLR2) ELISA Kit
RDR-TLR2-Ra-48Tests 48 Tests
EUR 534
Rat Toll Like Receptor 2 (TLR2) ELISA Kit
RDR-TLR2-Ra-96Tests 96 Tests
EUR 742
Human Toll Like Receptor 2 (TLR2) ELISA Kit
RD-TLR2-Hu-48Tests 48 Tests
EUR 478
Human Toll Like Receptor 2 (TLR2) ELISA Kit
RD-TLR2-Hu-96Tests 96 Tests
EUR 662
Mouse Toll Like Receptor 2 (TLR2) ELISA Kit
RD-TLR2-Mu-48Tests 48 Tests
EUR 489
Mouse Toll Like Receptor 2 (TLR2) ELISA Kit
RD-TLR2-Mu-96Tests 96 Tests
EUR 677
Rat Toll Like Receptor 2 (TLR2) ELISA Kit
RD-TLR2-Ra-48Tests 48 Tests
EUR 511
Rat Toll Like Receptor 2 (TLR2) ELISA Kit
RD-TLR2-Ra-96Tests 96 Tests
EUR 709
Anti-TLR2 Rabbit Monoclonal Antibody
M00131 100ug/vial
EUR 397
Description: Rabbit Monoclonal TLR2 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.
CD282 / TLR2(TLR2/221) Antibody
BNUB0221-100 100uL
EUR 209
Description: Primary antibody against CD282 / TLR2(TLR2/221), Concentration: 0.2mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNUB0221-500 500uL
EUR 458
Description: Primary antibody against CD282 / TLR2(TLR2/221), Concentration: 0.2mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNUM0221-50 50uL
EUR 395
Description: Primary antibody against CD282 / TLR2(TLR2/221), 1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC040221-100 100uL
EUR 199
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF405S conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC040221-500 500uL
EUR 544
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF405S conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC610221-100 100uL
EUR 199
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF660R conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC610221-500 500uL
EUR 544
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF660R conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC470221-100 100uL
EUR 199
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF647 conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC470221-500 500uL
EUR 544
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF647 conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC550221-100 100uL
EUR 199
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF555 conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC550221-500 500uL
EUR 544
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF555 conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC050221-100 100uL
EUR 199
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF405M conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC050221-500 500uL
EUR 544
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF405M conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC400221-100 100uL
EUR 199
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF640R conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC400221-500 500uL
EUR 544
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF640R conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC430221-100 100uL
EUR 199
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF543 conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC430221-500 500uL
EUR 544
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF543 conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC800221-100 100uL
EUR 199
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF680 conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC800221-500 500uL
EUR 544
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF680 conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC810221-100 100uL
EUR 199
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF680R conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC810221-500 500uL
EUR 544
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF680R conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNCP0221-250 250uL
EUR 383
Description: Primary antibody against CD282 / TLR2(TLR2/221), PerCP conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNCR0221-250 250uL
EUR 383
Description: Primary antibody against CD282 / TLR2(TLR2/221), RPE conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNCA0221-250 250uL
EUR 383
Description: Primary antibody against CD282 / TLR2(TLR2/221), APC conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNCAP0221-100 100uL
EUR 199
Description: Primary antibody against CD282 / TLR2(TLR2/221), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNCAP0221-500 500uL
EUR 544
Description: Primary antibody against CD282 / TLR2(TLR2/221), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNCH0221-100 100uL
EUR 199
Description: Primary antibody against CD282 / TLR2(TLR2/221), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNCH0221-500 500uL
EUR 544
Description: Primary antibody against CD282 / TLR2(TLR2/221), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC940221-100 100uL
EUR 199
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF594 conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC940221-500 500uL
EUR 544
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF594 conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC700221-100 100uL
EUR 199
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF770 conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC700221-500 500uL
EUR 544
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF770 conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNCB0221-100 100uL
EUR 199
Description: Primary antibody against CD282 / TLR2(TLR2/221), Biotin conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNCB0221-500 500uL
EUR 544
Description: Primary antibody against CD282 / TLR2(TLR2/221), Biotin conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC880221-100 100uL
EUR 199
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF488A conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC880221-500 500uL
EUR 544
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF488A conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC680221-100 100uL
EUR 199
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF568 conjugate, Concentration: 0.1mg/mL
CD282 / TLR2(TLR2/221) Antibody
BNC680221-500 500uL
EUR 544
Description: Primary antibody against CD282 / TLR2(TLR2/221), CF568 conjugate, Concentration: 0.1mg/mL
Polyclonal TLR2 Antibody (N-term)
APR10968G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR2 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal TLR2 Antibody (N-Terminus)
APR11212G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TLR2 (N-Terminus). This antibody is tested and proven to work in the following applications:
TLR2 Polyclonal Antibody, Biotin Conjugated
A54837 100 µg
EUR 570.55
Description: kits suitable for this type of research
TLR2 Polyclonal Antibody, FITC Conjugated
A54838 100 µg
EUR 570.55
Description: fast delivery possible
TLR2 Polyclonal Antibody, HRP Conjugated
A54839 100 µg
EUR 570.55
Description: reagents widely cited
Rabbit TLR2 ELISA Kit
ERTT0075 96Tests
EUR 521
TLR2 Antibody
24192-100ul 100ul
EUR 390
TLR2 antibody
20R-1639 100 ug
EUR 673
Description: Rabbit polyclonal TLR2 antibody
TLR2 antibody
70R-11905 100 ug
EUR 403
Description: Rabbit polyclonal TLR2 antibody
TLR2 Antibody
EUR 316
TLR2 Antibody
EUR 146
TLR2 Antibody
35576-100ul 100ul
EUR 252
TLR2 antibody
38422-100ul 100ul
EUR 252
TLR2 antibody
10R-6748 100 ul
EUR 705
Description: Mouse monoclonal TLR2 antibody
TLR2 antibody
10R-8043 100 ul
EUR 470
Description: Mouse monoclonal TLR2 antibody
TLR2 Antibody
49683-100ul 100ul
EUR 333
TLR2 Antibody
49683-50ul 50ul
EUR 239
TLR2 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR2. Recognizes TLR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200
TLR2 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TLR2. Recognizes TLR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1:200-500.ELISA:1/10000
TLR2 Antibody
DF7002 200ul
EUR 304
Description: TLR2 Antibody detects endogenous levels of total TLR2.
TLR2 Antibody
DF7521 200ul
EUR 304
Description: TLR2 Antibody detects endogenous levels of total TLR2.
TLR2 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR2. Recognizes TLR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200
TLR2 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR2. Recognizes TLR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
TLR2 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TLR2. Recognizes TLR2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
TLR2 Antibody
BF0067 200ul
EUR 376
Description: TLR2 antibody detects endogenous levels of total TLR2.
TLR2 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR2. Recognizes TLR2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
TLR2 Antibody
ABD7002 100 ug
EUR 438
TLR2 Antibody
ABD7521 100 ug
EUR 438
TLR2 antibody
PAab09836 100 ug
EUR 386
Polyclonal Mouse TLR2 Antibody (C-term)
APG02926G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse TLR2 (C-term). This antibody is tested and proven to work in the following applications:
Anti-TLR2 Antibody
A00131 100ug/vial
EUR 294
TLR2 Conjugated Antibody
C49683 100ul
EUR 397
TLR2 Conjugated Antibody
C35576 100ul
EUR 397
anti- TLR2 antibody
FNab09836 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: toll-like receptor 2
  • Uniprot ID: O60603
  • Gene ID: 7097
  • Research Area: Immunology, Signal Transduction, Developmental biology
Description: Antibody raised against TLR2
Anti-TLR2 Antibody
PA2247 100ug/vial
EUR 294
Anti-TLR2 antibody
STJ25865 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. This protein is a cell-surface protein that can form heterodimers with other TLR family members to recognize conserved molecules derived from microorganisms known as pathogen-associated molecular patterns (PAMPs). Activation of TLRs by PAMPs leads to an up-regulation of signaling pathways to modulate the host's inflammatory response. This gene is also thought to promote apoptosis in response to bacterial lipoproteins. This gene has been implicated in the pathogenesis of several autoimmune diseases. Alternative splicing results in multiple transcript variants.
Anti-TLR2 antibody
STJ113031 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. This protein is a cell-surface protein that can form heterodimers with other TLR family members to recognize conserved molecules derived from microorganisms known as pathogen-associated molecular patterns (PAMPs). Activation of TLRs by PAMPs leads to an up-regulation of signaling pathways to modulate the host's inflammatory response. This gene is also thought to promote apoptosis in response to bacterial lipoproteins. This gene has been implicated in the pathogenesis of several autoimmune diseases. Alternative splicing results in multiple transcript variants.
Anti-TLR2 antibody
STJ140050 150 µg
EUR 219
Description: Goat polyclonal antibody to TLR2. It is a 84 kDa type I transmembrane glycoprotein and a member of TLR family. It contains many leucine-rich repeat sequences and the intracellular Toll Interleukin Receptor Domain. TLR2 forms heterodimer with TLR1 and TLR6. It is expressed in peripheral blood leukocytes, and highly expressed in monocytes in bone marrow, lymph nodes, and spleen. It is also detectable in other tissues. This protein recognizes molecular patterns of bacteria, fungi, protozoan pathogens and stimulates pro-inflammatory cytokines as part of innate immunity.
Anti-TLR2 antibody
STJ16100479 100 µg
EUR 604
Anti-TLR2 antibody
STJ16100485 100 µg
EUR 604
Anti-TLR2 antibody
STJ16100486 50 µg
EUR 478
Anti-TLR2 antibody
STJ16100490 1 mL
EUR 604
Anti-TLR2 antibody
STJ16100491 0.5 ml
EUR 478
Anti-TLR2 antibody
STJ16100492 1 mL
EUR 604
Anti-TLR2 antibody
STJ16100493 0.5 ml
EUR 478
Anti-TLR2 antibody
STJ29799 100 µl
EUR 457
Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. This protein is a cell-surface protein that can form heterodimers with other TLR family members to recognize conserved molecules derived from microorganisms known as pathogen-associated molecular patterns (PAMPs). Activation of TLRs by PAMPs leads to an up-regulation of signaling pathways to modulate the host's inflammatory response. This gene is also thought to promote apoptosis in response to bacterial lipoproteins. This gene has been implicated in the pathogenesis of several autoimmune diseases. Alternative splicing results in multiple transcript variants.
Anti-TLR2 antibody
STJ97408 200 µl
EUR 197
Description: Rabbit polyclonal to TLR2.
Anti-TLR2 antibody
STJ98423 100 µl
EUR 234
Description: Mouse monoclonal to TLR2.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GT15234 100 ug
EUR 526
PVT10189 2 ug
EUR 301
RA30054 50 ug
EUR 618
TLR2 antibody (N-terminal)
70R-14928 50 ug
EUR 467
Description: Rabbit polyclonal TLR2 antibody (N-terminal)
TLR2 antibody (Middle Region)
70R-14929 50 ug
EUR 467
Description: Rabbit polyclonal TLR2 antibody (Middle Region)
TLR2 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR2. Recognizes TLR2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TLR2 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR2. Recognizes TLR2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TLR2 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLR2. Recognizes TLR2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Human)
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Pro47~Gly245)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 2 (TLR2)
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Human)
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Phe644~Ser784)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 2 (TLR2)
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Mouse)
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Gln25~Pro250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 2 (TLR2)
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Rat)
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Cys595~Thr760)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 2 (TLR2)
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Human), APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Pro47~Gly245)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 2 (TLR2). This antibody is labeled with APC.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Human), Biotinylated
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Pro47~Gly245)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 2 (TLR2). This antibody is labeled with Biotin.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Human), Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Pro47~Gly245)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 2 (TLR2). This antibody is labeled with Cy3.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Human), FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Pro47~Gly245)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 2 (TLR2). This antibody is labeled with FITC.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Human), HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Pro47~Gly245)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 2 (TLR2). This antibody is labeled with HRP.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Human), PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Pro47~Gly245)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 2 (TLR2). This antibody is labeled with PE.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Human), APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Phe644~Ser784)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 2 (TLR2). This antibody is labeled with APC.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Human), Biotinylated
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Phe644~Ser784)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 2 (TLR2). This antibody is labeled with Biotin.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Human), Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Phe644~Ser784)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 2 (TLR2). This antibody is labeled with Cy3.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Human), FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Phe644~Ser784)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 2 (TLR2). This antibody is labeled with FITC.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Human), HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Phe644~Ser784)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 2 (TLR2). This antibody is labeled with HRP.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Human), PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Phe644~Ser784)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 2 (TLR2). This antibody is labeled with PE.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Mouse), APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Gln25~Pro250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 2 (TLR2). This antibody is labeled with APC.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Mouse), Biotinylated
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Gln25~Pro250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 2 (TLR2). This antibody is labeled with Biotin.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Mouse), Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Gln25~Pro250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 2 (TLR2). This antibody is labeled with Cy3.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Mouse), FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Gln25~Pro250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 2 (TLR2). This antibody is labeled with FITC.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Mouse), HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Gln25~Pro250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 2 (TLR2). This antibody is labeled with HRP.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Mouse), PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Gln25~Pro250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 2 (TLR2). This antibody is labeled with PE.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Rat), APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Cys595~Thr760)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 2 (TLR2). This antibody is labeled with APC.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Rat), Biotinylated
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Cys595~Thr760)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 2 (TLR2). This antibody is labeled with Biotin.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Rat), Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Cys595~Thr760)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 2 (TLR2). This antibody is labeled with Cy3.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Rat), FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Cys595~Thr760)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 2 (TLR2). This antibody is labeled with FITC.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Rat), HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Cys595~Thr760)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 2 (TLR2). This antibody is labeled with HRP.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Rat), PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Cys595~Thr760)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 2 (TLR2). This antibody is labeled with PE.
TLR2 Antibody (Clone BV31-9)
EUR 370
Monoclonal Tlr2 Antibody, Clone: 8F11G10
APG02994G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human Tlr2. The antibodies are raised in Mouse and are from clone 8F11G10. This antibody is applicable in WB and IHC, FC, ICC, E
Monoclonal Tlr2 Antibody, Clone: 7G5F4
APR10967G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human Tlr2. The antibodies are raised in Mouse and are from clone 7G5F4. This antibody is applicable in WB and IHC, FC, ICC, E
TLR2 Blocking Peptide
33R-10800 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TLR2 antibody, catalog no. 70R-11905
TLR2 Blocking Peptide
EUR 153
EUR 756
EUR 229
TLR2 Blocking Peptide
DF7002-BP 1mg
EUR 195
TLR2 Blocking Peptide
DF7521-BP 1mg
EUR 195
TLR2 Blocking Peptide
BF0067-BP 1mg
EUR 195
TLR2 cloning plasmid
CSB-CL023601HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2355
  • Sequence: atgccacatactttgtggatggtgtgggtcttgggggtcatcatcagcctctccaaggaagaatcctccaatcaggcttctctgtcttgtgaccgcaatggtatctgcaagggcagctcaggatctttaaactccattccctcagggctcacagaagctgtaaaaagccttgacc
  • Show more
Description: A cloning plasmid for the TLR2 gene.
Anti-TLR2 (2A3)
YF-MA15876 100 ug
EUR 363
Description: Mouse monoclonal to TLR2
Anti-TLR2 (2D2)
YF-MA15877 100 ug
EUR 363
Description: Mouse monoclonal to TLR2
Anti-TLR2 (3F10)
YF-MA15878 100 ug
EUR 363
Description: Mouse monoclonal to TLR2
Anti-TLR2 (4D6)
YF-MA15879 100 ug
EUR 363
Description: Mouse monoclonal to TLR2
Anti-TLR2 (1C6)
YF-MA15880 100 ug
EUR 363
Description: Mouse monoclonal to TLR2
Anti-TLR2 (1E7)
YF-MA15881 100 ug
EUR 363
Description: Mouse monoclonal to TLR2
Anti-TLR2 (4G9)
YF-MA15882 100 ug
EUR 363
Description: Mouse monoclonal to TLR2
Anti-TLR2 (1B10)
YF-MA15883 100 ug
EUR 363
Description: Mouse monoclonal to TLR2
Anti-TLR2 (1E3)
YF-MA15884 100 ug
EUR 363
Description: Mouse monoclonal to TLR2
Anti-TLR2 (4C4)
YF-MA15885 100 ug
EUR 363
Description: Mouse monoclonal to TLR2
Anti-TLR2 (4C10)
YF-MA15886 100 ug
EUR 363
Description: Mouse monoclonal to TLR2
Anti-TLR2 (3H8)
YF-MA15887 100 ug
EUR 363
Description: Mouse monoclonal to TLR2
Anti-TLR2 (4H6)
YF-MA15888 100 ug
EUR 363
Description: Mouse monoclonal to TLR2
Anti-TLR2 (3E3)
YF-MA15889 200 ul
EUR 363
Description: Mouse monoclonal to TLR2
Anti-TLR2 (2G9)
YF-MA15890 100 ug
EUR 363
Description: Mouse monoclonal to TLR2
Rabbit Toll Like Receptor 2 (TLR2) ELISA Kit
abx362571-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Human), APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Pro47~Gly245)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 2 (TLR2). This antibody is labeled with APC-Cy7.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Human), APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Phe644~Ser784)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Toll Like Receptor 2 (TLR2). This antibody is labeled with APC-Cy7.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Mouse), APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Gln25~Pro250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Toll Like Receptor 2 (TLR2). This antibody is labeled with APC-Cy7.
Toll Like Receptor 2 (TLR2) Polyclonal Antibody (Rat), APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TLR2 (Cys595~Thr760)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Toll Like Receptor 2 (TLR2). This antibody is labeled with APC-Cy7.
Toll-Like Receptor 2 (TLR2) Antibody
abx027542-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Toll-Like Receptor 2 (TLR2) Antibody
abx027542-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Toll Like Receptor 2 (TLR2) Antibody
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.
Toll-Like Receptor 2 (Tlr2) Antibody
abx224269-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Toll Like Receptor 2 (TLR2) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Toll Like Receptor 2 (TLR2) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Toll Like Receptor 2 (TLR2) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Toll Like Receptor 2 (TLR2) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Toll Like Receptor 2 (TLR2) Antibody
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Toll Like Receptor 2 (TLR2) Antibody
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Toll Like Receptor 2 (TLR2) Antibody
  • EUR 314.00
  • EUR 787.00
  • EUR 411.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
Toll Like Receptor 2 (TLR2) Antibody
  • EUR 314.00
  • EUR 787.00
  • EUR 411.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
Toll Like Receptor 2 (TLR2) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Toll-Like Receptor 2 (TLR2) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Toll-Like Receptor 2 (TLR2) Antibody
  • EUR 592.00
  • EUR 857.00
  • EUR 411.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Toll-Like Receptor 2 (TLR2) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Toll Like Receptor 2 (TLR2) Antibody
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Toll-Like Receptor 2 (TLR2) Antibody
abx147259-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Toll-Like Receptor 2 (TLR2) Antibody
abx147260-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Toll-Like Receptor 2 (TLR2) Antibody
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Toll Like Receptor 2 (TLR2) Antibody
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Toll-Like Receptor 2 (TLR2) Antibody
abx011833-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.
Toll-Like Receptor 2 (TLR2) Antibody
abx028479-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Toll-Like Receptor 2 (TLR2) Antibody
abx028479-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Toll-Like Receptor 2 (Tlr2) Antibody
abx028480-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Toll-Like Receptor 2 (Tlr2) Antibody
abx028480-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Toll Like Receptor 2 (TLR2) Antibody
  • EUR 467.00
  • EUR 537.00
  • EUR 272.00
  • EUR 815.00
  • EUR 356.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.
Toll Like Receptor 2 (TLR2) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Toll-Like Receptor 2 (Tlr2) Antibody
abx224396-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Toll-Like Receptor 2 (TLR2) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Human TLR2 ELISA Kit
55R-1791 1 kit
EUR 651
Description: ELISA Kit for detection of TLR2 in the research laboratory
Human TLR2 ELISA Kit
EHT0075 96Tests
EUR 521

TLR2 Rabbit Polyclonal Antibody