SPOP Rabbit Polyclonal Antibody

SPOP Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

SPOP Polyclonal Antibody

ABP57529-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from SPOP at AA range: 41-90
  • Applications tips:
Description: A polyclonal antibody for detection of SPOP from Human, Mouse, Rat. This SPOP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from SPOP at AA range: 41-90

SPOP Polyclonal Antibody

ABP57529-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from SPOP at AA range: 41-90
  • Applications tips:
Description: A polyclonal antibody for detection of SPOP from Human, Mouse, Rat. This SPOP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from SPOP at AA range: 41-90

SPOP Polyclonal Antibody

ABP57529-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from SPOP at AA range: 41-90
  • Applications tips:
Description: A polyclonal antibody for detection of SPOP from Human, Mouse, Rat. This SPOP antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from SPOP at AA range: 41-90

SPOP Polyclonal Antibody

ES8522-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SPOP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

SPOP Polyclonal Antibody

ES8522-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SPOP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

SPOP Rabbit pAb

A12106-100ul 100 ul
EUR 308

SPOP Rabbit pAb

A12106-200ul 200 ul
EUR 459

SPOP Rabbit pAb

A12106-20ul 20 ul
EUR 183

SPOP Rabbit pAb

A12106-50ul 50 ul
EUR 223

SPOP Rabbit pAb

A7621-100ul 100 ul
EUR 308

SPOP Rabbit pAb

A7621-200ul 200 ul
EUR 459

SPOP Rabbit pAb

A7621-20ul 20 ul
EUR 183

SPOP Rabbit pAb

A7621-50ul 50 ul
EUR 223

SPOP Polyclonal Conjugated Antibody

C46746 100ul
EUR 397

SPOP Antibody

DF12106 200ul
EUR 304
Description: SPOP antibody detects endogenous levels of SPOP.

SPOP antibody

70R-8876 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SPOP antibody

SPOP Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPOP. Recognizes SPOP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


ERTS0183 96Tests
EUR 521

SPOP Polyclonal Antibody, Biotin Conjugated

A61131 100 µg
EUR 570.55
Description: The best epigenetics products

SPOP Polyclonal Antibody, FITC Conjugated

A61132 100 µg
EUR 570.55
Description: kits suitable for this type of research

SPOP Polyclonal Antibody, HRP Conjugated

A61133 100 µg
EUR 570.55
Description: fast delivery possible

Anti-SPOP Antibody

A02032 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for SPOP Antibody (SPOP) detection.tested for IHC, WB in Human, Mouse, Rat.

anti- SPOP antibody

FNab08189 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:500
  • IP : 1:500-1:1000
  • Immunogen: speckle-type POZ protein
  • Uniprot ID: O43791
  • Gene ID: 8405
  • Research Area: Metabolism
Description: Antibody raised against SPOP

Anti-SPOP antibody

PAab08189 100 ug
EUR 386

Anti-SPOP antibody

STJ114000 100 µl
EUR 277
Description: This gene encodes a protein that may modulate the transcriptional repression activities of death-associated protein 6 (DAXX), which interacts with histone deacetylase, core histones, and other histone-associated proteins. In mouse, the encoded protein binds to the putative leucine zipper domain of macroH2A1.2, a variant H2A histone that is enriched on inactivated X chromosomes. The BTB/POZ domain of this protein has been shown in other proteins to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes. Alternative splicing of this gene results in multiple transcript variants encoding the same protein.

Anti-SPOP antibody

STJ29758 100 µl
EUR 277
Description: This gene encodes a protein that may modulate the transcriptional repression activities of death-associated protein 6 (DAXX), which interacts with histone deacetylase, core histones, and other histone-associated proteins. In mouse, the encoded protein binds to the putative leucine zipper domain of macroH2A1.2, a variant H2A histone that is enriched on inactivated X chromosomes. The BTB/POZ domain of this protein has been shown in other proteins to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes. Alternative splicing of this gene results in multiple transcript variants encoding the same protein.

Anti-SPOP antibody

STJ98635 200 µl
EUR 197
Description: Rabbit polyclonal to SPOP.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA15616 50 ug
EUR 363
Description: Mouse polyclonal to SPOP


YF-PA15617 100 ug
EUR 403
Description: Rabbit polyclonal to SPOP

SPOP Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPOP. Recognizes SPOP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SPOP Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPOP. Recognizes SPOP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SPOP Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPOP. Recognizes SPOP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SPOP Blocking Peptide

33R-10118 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SPOP antibody, catalog no. 70R-8876

SPOP Blocking Peptide

DF12106-BP 1mg
EUR 195

SPOP cloning plasmid

CSB-CL022601HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1125
  • Sequence: atgtcaagggttccaagtcctccacctccggcagaaatgtcgagtggccccgtagctgagagttggtgctacacacagatcaaggtagtgaaattctcctacatgtggaccatcaataactttagcttttgccgggaggaaatgggtgaagtcattaaaagttctacattttcat
  • Show more
Description: A cloning plasmid for the SPOP gene.


PVT12410 2 ug
EUR 391

Anti-SPOP (3E2)

YF-MA16346 100 ug
EUR 363
Description: Mouse monoclonal to SPOP

Rabbit Speckle Type POZ Protein (SPOP) ELISA Kit

abx362370-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Speckle Type POZ Protein (SPOP) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Speckle Type POZ Protein (SPOP) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Speckle Type POZ Protein (SPOP) Antibody

abx238189-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Speckle Type POZ Protein (SPOP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SPOP protein (His tag)

80R-1767 50 ug
EUR 397
Description: Purified recombinant Human SPOP protein


EHS0183 96Tests
EUR 521


EBS0183 96Tests
EUR 521

Anserine SPOP ELISA Kit

EAS0183 96Tests
EUR 521


ECS0183 96Tests
EUR 521


EGTS0183 96Tests
EUR 521


EF003198 96 Tests
EUR 689

Mouse SPOP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SPOP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Porcine SPOP ELISA Kit

EPS0183 96Tests
EUR 521


ERS0183 96Tests
EUR 521


EMS0183 96Tests
EUR 521


PVT12979 2 ug
EUR 703

Speckle Type POZ Protein (SPOP) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Speckle Type POZ Protein (SPOP) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Speckle Type POZ Protein (SPOP) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Guinea Pig SPOP ELISA Kit

EGS0183 96Tests
EUR 521

Spop ORF Vector (Rat) (pORF)

ORF076963 1.0 ug DNA
EUR 506

SPOP ORF Vector (Human) (pORF)

ORF009989 1.0 ug DNA
EUR 95

Spop ORF Vector (Mouse) (pORF)

ORF058398 1.0 ug DNA
EUR 506

SPOP ELISA Kit (Human) (OKEI00190)

OKEI00190 96 Wells
EUR 767
Description: Description of target: Component of a cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex that mediates the ubiquitination of target proteins, leading most often to their proteasomal degradation. In complex with CUL3, involved in ubiquitination and proteasomal degradation of BRMS1, DAXX, PDX1/IPF1, GLI2 and GLI3. In complex with CUL3, involved in ubiquitination of H2AFY and BMI1; this does not lead to their proteasomal degradation. Inhibits transcriptional activation of PDX1/IPF1 targets, such as insulin, by promoting PDX1/IPF1 degradation. The cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex containing homodimeric SPOP has higher ubiquitin ligase activity than the complex that contains the heterodimer formed by SPOP and SPOPL.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.469 ng/mL

SPOP ELISA Kit (Mouse) (OKEI00554)

OKEI00554 96 Wells
EUR 767
Description: Description of target: Component of a cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex that mediates the ubiquitination of target proteins, leading most often to their proteasomal degradation. The cullin-RING-based BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex containing homodimeric SPOP has higher ubiquitin ligase activity than the complex that contains the heterodimer formed by SPOP and SPOPL.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

Speckle Type POZ Protein (SPOP) Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Spop sgRNA CRISPR Lentivector set (Rat)

K6617601 3 x 1.0 ug
EUR 339

SPOP Rabbit Polyclonal Antibody