SOD2 Rabbit Polyclonal Antibody

SOD2 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

SOD2 Polyclonal Antibody

A50492 100 µg
EUR 570.55
Description: reagents widely cited

SOD2 Polyclonal Antibody

ABP57228-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human SOD-2
  • Applications tips:
Description: A polyclonal antibody for detection of SOD2 from Human, Mouse, Rat. This SOD2 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human SOD-2

SOD2 Polyclonal Antibody

ABP57228-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human SOD-2
  • Applications tips:
Description: A polyclonal antibody for detection of SOD2 from Human, Mouse, Rat. This SOD2 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human SOD-2

SOD2 Polyclonal Antibody

ABP57228-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human SOD-2
  • Applications tips:
Description: A polyclonal antibody for detection of SOD2 from Human, Mouse, Rat. This SOD2 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human SOD-2

SOD2 Polyclonal Antibody

ABP57241-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human SOD-2
  • Applications tips:
Description: A polyclonal antibody for detection of SOD2 from Human, Mouse, Rat. This SOD2 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human SOD-2

SOD2 Polyclonal Antibody

ABP57241-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human SOD-2
  • Applications tips:
Description: A polyclonal antibody for detection of SOD2 from Human, Mouse, Rat. This SOD2 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human SOD-2

SOD2 Polyclonal Antibody

ABP57241-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human SOD-2
  • Applications tips:
Description: A polyclonal antibody for detection of SOD2 from Human, Mouse, Rat. This SOD2 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human SOD-2

SOD2 Polyclonal Antibody

ES8227-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SOD2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

SOD2 Polyclonal Antibody

ES8227-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SOD2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

SOD2 Polyclonal Antibody

ES8240-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SOD2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

SOD2 Polyclonal Antibody

ES8240-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SOD2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

SOD2 Rabbit pAb

A1340-100ul 100 ul
EUR 308

SOD2 Rabbit pAb

A1340-200ul 200 ul
EUR 459

SOD2 Rabbit pAb

A1340-20ul 20 ul
EUR 183

SOD2 Rabbit pAb

A1340-50ul 50 ul
EUR 223

SOD2 Rabbit mAb

A19576-100ul 100 ul
EUR 410

SOD2 Rabbit mAb

A19576-200ul 200 ul
EUR 571

SOD2 Rabbit mAb

A19576-20ul 20 ul
EUR 221

SOD2 Rabbit mAb

A19576-50ul 50 ul
EUR 287

Polyclonal MNSOD / SOD2 Antibody

APR08470G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MNSOD / SOD2 . This antibody is tested and proven to work in the following applications:

Polyclonal MNSOD / SOD2 Antibody

APR08471G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MNSOD / SOD2 . This antibody is tested and proven to work in the following applications:

Polyclonal MNSOD / SOD2 Antibody

APR08472G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MNSOD / SOD2 . This antibody is tested and proven to work in the following applications:

Human Superoxide Dismutase 2, Mitochondrial (SOD2) ELISA Kit

DLR-SOD2-Hu-48T 48T
EUR 498
  • Should the Human Superoxide Dismutase 2, Mitochondrial (SOD2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Superoxide Dismutase 2, Mitochondrial (SOD2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Superoxide Dismutase 2, Mitochondrial (SOD2) ELISA Kit

DLR-SOD2-Hu-96T 96T
EUR 647
  • Should the Human Superoxide Dismutase 2, Mitochondrial (SOD2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Superoxide Dismutase 2, Mitochondrial (SOD2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Superoxide Dismutase 2, Mitochondrial (SOD2) ELISA Kit

DLR-SOD2-Ra-48T 48T
EUR 528
  • Should the Rat Superoxide Dismutase 2, Mitochondrial (SOD2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Superoxide Dismutase 2, Mitochondrial (SOD2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Superoxide Dismutase 2, Mitochondrial (SOD2) ELISA Kit

DLR-SOD2-Ra-96T 96T
EUR 690
  • Should the Rat Superoxide Dismutase 2, Mitochondrial (SOD2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Superoxide Dismutase 2, Mitochondrial (SOD2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Superoxide Dismutase 2, Mitochondrial (SOD2) ELISA Kit

RD-SOD2-Hu-48Tests 48 Tests
EUR 500

Human Superoxide Dismutase 2, Mitochondrial (SOD2) ELISA Kit

RD-SOD2-Hu-96Tests 96 Tests
EUR 692

Rat Superoxide Dismutase 2, Mitochondrial (SOD2) ELISA Kit

RD-SOD2-Ra-48Tests 48 Tests
EUR 534

Rat Superoxide Dismutase 2, Mitochondrial (SOD2) ELISA Kit

RD-SOD2-Ra-96Tests 96 Tests
EUR 742

Human Superoxide Dismutase 2, Mitochondrial (SOD2) ELISA Kit

RDR-SOD2-Hu-48Tests 48 Tests
EUR 522

Human Superoxide Dismutase 2, Mitochondrial (SOD2) ELISA Kit

RDR-SOD2-Hu-96Tests 96 Tests
EUR 724

Rat Superoxide Dismutase 2, Mitochondrial (SOD2) ELISA Kit

RDR-SOD2-Ra-48Tests 48 Tests
EUR 558

Rat Superoxide Dismutase 2, Mitochondrial (SOD2) ELISA Kit

RDR-SOD2-Ra-96Tests 96 Tests
EUR 776

SOD2 Polyclonal Antibody, HRP Conjugated

A50493 100 µg
EUR 570.55
Description: Ask the seller for details

SOD2 Polyclonal Antibody, FITC Conjugated

A50494 100 µg
EUR 570.55
Description: The best epigenetics products

SOD2 Polyclonal Antibody, Biotin Conjugated

A50495 100 µg
EUR 570.55
Description: kits suitable for this type of research

Rabbit SOD2 ELISA Kit

ERTS0151 96Tests
EUR 521

SOD2 antibody

20R-2884 100 ul
EUR 393
Description: Rabbit polyclonal SOD2 antibody

SOD2 antibody

20R-2994 100 ul
EUR 393
Description: Rabbit polyclonal SOD2 antibody

SOD2 antibody

70R-14313 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal SOD2 antibody

SOD2 Antibody

32265-100ul 100ul
EUR 252

SOD2 antibody

10R-5887 100 ul
EUR 726
Description: Mouse monoclonal SOD2 antibody

SOD2 Antibody

49265-100ul 100ul
EUR 333

SOD2 Antibody

49265-50ul 50ul
EUR 239

SOD2 Antibody

1-CSB-PA006154
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SOD2. Recognizes SOD2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

SOD2 Antibody

1-CSB-PA080201
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against SOD2. Recognizes SOD2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500

SOD2 Antibody

1-CSB-PA080216
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against SOD2. Recognizes SOD2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500

SOD2 Antibody

1-CSB-PA112138
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SOD2. Recognizes SOD2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

SOD2 Antibody

DF6390 200ul
EUR 304
Description: SOD2 Antibody detects endogenous levels of total SOD2.

SOD2 Antibody

1-CSB-PA187305
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SOD2. Recognizes SOD2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

SOD2 antibody

70R-5749 50 ug
EUR 467
Description: Rabbit polyclonal SOD2 antibody raised against the N terminal of SOD2

sod2 Antibody

AF5144 200ul
EUR 304
Description: sod2 Antibody detects endogenous levels of total sod2.

SOD2 Antibody

CSB-PA022398KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against SOD2. Recognizes SOD2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

SOD2 Antibody

CSB-PA022398KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against SOD2. Recognizes SOD2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

SOD2 Antibody

1-CSB-PA022398LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SOD2. Recognizes SOD2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:600, IF:1:200-1:500, IP:1:200-1:2000

SOD2 Antibody

ABD6390 100 ug
EUR 438

sod2 Antibody

ABF5144 100 ug
EUR 438

Anti-SOD2/Mnsod Rabbit Monoclonal Antibody

M00349 100ug/vial
EUR 397
Description: Rabbit Monoclonal SOD2/Mnsod Antibody. Validated in WB, IHC and tested in Human, Mouse, Rat.

SOD2 ELISA Kit (Rabbit) (OKCA01820)

OKCA01820 96 Wells
EUR 930
Description: Description of target: Destroys superoxide anion radicals which are normally produced within the cells and which are toxic to biological systems. ;Species reactivity: Rabbit;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 31.25 pg/mL

SOD2

MO15122 100 ug
EUR 409

Human SOD2 Antibody

32611-05111 150 ug
EUR 261

SOD2 Conjugated Antibody

C49265 100ul
EUR 397

SOD2/MnSOD Antibody

AF4660 200ul
EUR 376
Description: SOD2/MnSOD Antibody detects endogenous levels of SOD2/MnSOD.

SOD2 Conjugated Antibody

C32265 100ul
EUR 397

anti- SOD2 antibody

FNab08104 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:500-1:5000
  • IHC: 1:100-1:400
  • IF: 1:20-1:200
  • Immunogen: superoxide dismutase 2, mitochondrial
  • Uniprot ID: P04179
  • Gene ID: 6648
  • Research Area: Neuroscience, Cardiovascular, Metabolism
Description: Antibody raised against SOD2

Anti-SOD2 Antibody

PA1776 100ug/vial
EUR 334

Anti-SOD2 antibody

PAab08104 100 ug
EUR 386

Anti-SOD2 Antibody

PB9442 100ug/vial
EUR 334

Anti-SOD2 antibody

STJ25654 100 µl
EUR 277
Description: This gene is a member of the iron/manganese superoxide dismutase family. It encodes a mitochondrial protein that forms a homotetramer and binds one manganese ion per subunit. This protein binds to the superoxide byproducts of oxidative phosphorylation and converts them to hydrogen peroxide and diatomic oxygen. Mutations in this gene have been associated with idiopathic cardiomyopathy (IDC), premature aging, sporadic motor neuron disease, and cancer. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 1.

Anti-SOD2 antibody

STJ97424 200 µl
EUR 197
Description: Rabbit polyclonal to SOD2.

Anti-SOD2 antibody

STJ97438 200 µl
EUR 197
Description: Rabbit polyclonal to SOD2.

Rabbit Anti-SOD2 monoclonal antibody, clone KK1900-12

CABT-L836 100 ul
EUR 777

SOD2 protein

30R-2996 500 ug
EUR 224
Description: Purified recombinant SOD2 protein

SOD2 protein

80R-4214 100 ug
EUR 349
Description: Recombinant Mouse SOD2 protein with His tag

SOD2 protein

E20-80095 20ug
EUR 408

SOD2 protein

E20-80096 20ug
EUR 408

SOD2 Protein

E70001 25 µg
EUR 499.5
Description: Ask the seller for details

SOD2 siRNA

20-abx905205
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SOD2 siRNA

20-abx934662
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SOD2 siRNA

20-abx934663
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SOD2

LF-PA0214 100 ul
EUR 334
Description: Rabbit polyclonal to SOD2

pENTR223- SOD2

PVT11431 2 ug
EUR 273

Mouse SOD2/MnSOD Antibody

33095-05111 150 ug
EUR 261

Monoclonal MNSOD / SOD2 Antibody

APR08473G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human MNSOD / SOD2. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P, E

SOD2 Antibody, HRP conjugated

1-CSB-PA022398LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SOD2. Recognizes SOD2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SOD2 Antibody, FITC conjugated

1-CSB-PA022398LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SOD2. Recognizes SOD2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SOD2 Antibody, Biotin conjugated

1-CSB-PA022398LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SOD2. Recognizes SOD2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SOD2 recombinant monoclonal antibody

A5377 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human SOD2 for WB,ELISA

Human SOD2 Antibody (Biotin Conjugate)

32611-05121 150 ug
EUR 369

Monoclonal SOD2 Antibody, Clone: EPR2560Y

APR10197G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human SOD2. The antibodies are raised in Rabbit and are from clone EPR2560Y. This antibody is applicable in WB and IHC

Monoclonal SOD2 Antibody, Clone: 37CT127.5.11.6

APR10198G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human SOD2. The antibodies are raised in Mouse and are from clone 37CT127.5.11.6. This antibody is applicable in IHC-P, WB, E

Acetyl-SOD2/MnSOD (Lys122) Antibody

AF4360 200ul
EUR 376
Description: Acetyl-SOD2/MnSOD (K122) Antibody detects endogenous levels of Acetyl-SOD2/MnSOD (K122).

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Human, Pig)

4-PAB083Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Superoxide Dismutase 2, Mitochondrial (SOD2)

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Mouse, Rat)

4-PAB083Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Superoxide Dismutase 2, Mitochondrial (SOD2)

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Human, Rat)

4-PAB083Ra01
  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Superoxide Dismutase 2, Mitochondrial (SOD2)

SOD2 Blocking Peptide

33R-6219 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SOD2 antibody, catalog no. 70R-5749

SOD2 ELISA kit

55R-1868 1 kit
EUR 743
Description: ELISA kit for the detection of SOD2 in the research laboratory

SOD2 Blocking Peptide

DF6390-BP 1mg
EUR 195

sod2 Blocking Peptide

AF5144-BP 1mg
EUR 195

SOD2 cloning plasmid

CSB-CL022398HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 669
  • Sequence: atgttgagccgggcagtgtgcggcaccagcaggcagctggctccggttttggggtatctgggctccaggcagaagcacagcctccccgacctgccctacgactacggcgccctggaacctcacatcaacgcgcagatcatgcagctgcaccacagcaagcaccacgcggcctacgt
  • Show more
Description: A cloning plasmid for the SOD2 gene.

SOD2 cloning plasmid

CSB-CL022398HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 423
  • Sequence: atgttgagccgggcagtgtgcggcaccagcaggcagctggctccggctttggggtatctgggctccaggcagaagcacagcctccccgacctgccctacgactacggcgccctggaacctcacatcaacgcgcagatcatgcagctgcaccacagcaagcaccacgcggcctacgt
  • Show more
Description: A cloning plasmid for the SOD2 gene.

Rabbit Superoxide dismutase [Mn], mitochondrial (Sod2) ELISA Kit

abx259349-96tests 96 tests
EUR 981
  • Shipped within 5-12 working days.

Rabbit Super Oxidase Dimutase 2, SOD2 ELISA kit

ELI-07094Ra 96 Tests
EUR 928

Rabbit Sod2(Superoxide dismutase [Mn], mitochondrial) ELISA Kit

ERB0162 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rabbit;Sensitivity: 0.094 ng/ml

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Human, Pig), APC

4-PAB083Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with APC.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Human, Pig), Biotinylated

4-PAB083Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with Biotin.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Human, Pig), Cy3

4-PAB083Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with Cy3.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Human, Pig), FITC

4-PAB083Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with FITC.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Human, Pig), HRP

4-PAB083Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with HRP.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Human, Pig), PE

4-PAB083Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with PE.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Mouse, Rat), APC

4-PAB083Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with APC.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Mouse, Rat), Biotinylated

4-PAB083Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with Biotin.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Mouse, Rat), Cy3

4-PAB083Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with Cy3.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Mouse, Rat), FITC

4-PAB083Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with FITC.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Mouse, Rat), HRP

4-PAB083Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with HRP.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Mouse, Rat), PE

4-PAB083Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with PE.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Human, Rat), APC

4-PAB083Ra01-APC
  • EUR 352.00
  • EUR 3383.00
  • EUR 939.00
  • EUR 450.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with APC.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Human, Rat), Biotinylated

4-PAB083Ra01-Biotin
  • EUR 316.00
  • EUR 2539.00
  • EUR 747.00
  • EUR 388.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with Biotin.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Human, Rat), Cy3

4-PAB083Ra01-Cy3
  • EUR 428.00
  • EUR 4469.00
  • EUR 1211.00
  • EUR 559.00
  • EUR 255.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with Cy3.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Human, Rat), FITC

4-PAB083Ra01-FITC
  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with FITC.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Human, Rat), HRP

4-PAB083Ra01-HRP
  • EUR 322.00
  • EUR 2948.00
  • EUR 830.00
  • EUR 407.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with HRP.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Human, Rat), PE

4-PAB083Ra01-PE
  • EUR 302.00
  • EUR 2726.00
  • EUR 771.00
  • EUR 380.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with PE.

Human SOD2 AssayLite Antibody (FITC Conjugate)

32611-05141 150 ug
EUR 428

Human SOD2 AssayLite Antibody (RPE Conjugate)

32611-05151 150 ug
EUR 428

Human SOD2 AssayLite Antibody (APC Conjugate)

32611-05161 150 ug
EUR 428

Human SOD2 AssayLite Antibody (PerCP Conjuate)

32611-05171 150 ug
EUR 471

Mouse SOD2/MnSOD Antibody (Biotin Conjugate)

33095-05121 150 ug
EUR 369

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody

abx025545-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody

abx025545-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody

abx018046-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

Superoxide Dismutase 2, Mitochondrial (SOD2) Antibody

abx018324-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Superoxide Dismutase 2, Mitochondrial (SOD2) Antibody

20-abx103947
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Superoxide Dismutase 2, Mitochondrial (SOD2) Antibody

20-abx103948
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Superoxide Dismutase 2, Mitochondrial (SOD2) Antibody

20-abx103949
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody

abx117084-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody

20-abx134606
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Superoxide Dismutase 2, Mitochondrial (SOD2) Antibody

abx122793-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody

abx146838-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody

abx147234-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody

20-abx142238
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Superoxide Dismutase 2, Mitochondrial (SOD2) Antibody

20-abx174661
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Superoxide Dismutase 2, Mitochondrial (SOD2) Antibody

20-abx174662
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Superoxide Dismutase 2, Mitochondrial (SOD2) Antibody

abx238104-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody

20-abx242318
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody

20-abx242319
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody

20-abx326906
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody

20-abx326909
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody

20-abx327297
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody

20-abx318487
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody

20-abx445149
  • EUR 537.00
  • EUR 356.00
  • 100 ug
  • 25 ug
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody

20-abx445156
  • EUR 537.00
  • EUR 356.00
  • 100 ug
  • 25 ug
  • Shipped within 5-12 working days.

Superoxide Dismutase 2, Mitochondrial (SOD2) Antibody

abx224328-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Superoxide Dismutase 2, Mitochondrial (SOD2) Antibody

abx224441-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody

20-abx001193
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

SOD2 protein (His tag)

80R-1279 100 ug
EUR 268
Description: Purified recombinant Human SOD2 protein

Human SOD2 ELISA Kit

ELA-E2219h 96 Tests
EUR 824

Human SOD2 ELISA Kit

EHS0151 96Tests
EUR 521

Bovine SOD2 ELISA Kit

EBS0151 96Tests
EUR 521

Anserini SOD2 ELISA Kit

EAS0151 96Tests
EUR 521

Chicken SOD2 ELISA Kit

ECKS0151 96Tests
EUR 521

Canine SOD2 ELISA Kit

ECS0151 96Tests
EUR 521

Goat SOD2 ELISA Kit

EGTS0151 96Tests
EUR 521

SOD2 ELISA KIT|Human

EF006238 96 Tests
EUR 689

SOD2/MnSOD Blocking Peptide

AF4660-BP 1mg
EUR 195

Mouse SOD2 shRNA Plasmid

20-abx972816
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SOD2 shRNA Plasmid

20-abx984638
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SOD2 shRNA Plasmid

20-abx954528
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Porcine SOD2 ELISA Kit

EPS0151 96Tests
EUR 521

Sheep SOD2 ELISA Kit

ESS0151 96Tests
EUR 521

Rat SOD2 ELISA Kit

ERS0151 96Tests
EUR 521

Monkey SOD2 ELISA Kit

EMKS0151 96Tests
EUR 521

Mouse SOD2 ELISA Kit

EMS0151 96Tests
EUR 521

SOD2 Recombinant Protein (Rat)

RP230453 100 ug Ask for price

pECMV-3-FLAG-SOD2

PVT13341 2 ug
EUR 599

SOD2 Recombinant Protein (Human)

RP029686 100 ug Ask for price

SOD2 Recombinant Protein (Human)

RP029689 100 ug Ask for price

SOD2 Recombinant Protein (Mouse)

RP174467 100 ug Ask for price

Rat SOD2 ELISA Kit

STJ150416 1 kit
EUR 412
Description: The kit is a competitive enzyme immunoassay for in vitro quantitative measurement of SOD2 in Rat serum, plasma and other biological fluids

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Human, Pig), APC-Cy7

4-PAB083Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with APC-Cy7.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Mouse, Rat), APC-Cy7

4-PAB083Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with APC-Cy7.

Superoxide Dismutase 2, Mitochondrial (SOD2) Polyclonal Antibody (Human, Rat), APC-Cy7

4-PAB083Ra01-APC-Cy7
  • EUR 585.00
  • EUR 6646.00
  • EUR 1759.00
  • EUR 781.00
  • EUR 326.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SOD2 (Lys25~Lys222)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Superoxide Dismutase 2, Mitochondrial (SOD2). This antibody is labeled with APC-Cy7.

Mouse SOD2/MnSOD AssayLite Antibody (FITC Conjugate)

33095-05141 150 ug
EUR 428

Mouse SOD2/MnSOD AssayLite Antibody (RPE Conjugate)

33095-05151 150 ug
EUR 428

Mouse SOD2/MnSOD AssayLite Antibody (APC Conjugate)

33095-05161 150 ug
EUR 428

Mouse SOD2/MnSOD AssayLite Antibody (PerCP Conjugate)

33095-05171 150 ug
EUR 471

Superoxide Dismutase 2, Mitochondrial (SOD2) Antibody (Biotin)

20-abx271787
  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Superoxide Dismutase 2, Mitochondrial (SOD2) Antibody (Biotin)

20-abx272595
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Superoxide Dismutase 2, Mitochondrial (SOD2) Antibody (Biotin)

20-abx273093
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (ALP)

abx447257-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (APC)

abx447258-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (Biotin)

abx447259-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (FITC)

abx447260-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (HRP)

abx447261-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (PerCP)

abx447263-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (RPE)

abx447264-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (Streptavidin)

abx447265-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (ALP)

abx446254-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (APC)

abx446255-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (Biotin)

abx446256-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (FITC)

abx446257-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (HRP)

abx446258-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (PerCP)

abx446260-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (RPE)

abx446261-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (Streptavidin)

abx446262-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase 2, Mitochondrial (SOD2) Antibody (FITC)

20-abx273725
  • EUR 467.00
  • EUR 244.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Superoxide Dismutase 2, Mitochondrial (SOD2) Antibody (FITC)

20-abx273951
  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Superoxide Dismutase 2, Mitochondrial (SOD2) Antibody (FITC)

20-abx274099
  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 690.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (HRP)

20-abx305394
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (FITC)

20-abx305395
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (Biotin)

20-abx305396
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Guinea Pig SOD2 ELISA Kit

EGS0151 96Tests
EUR 521

Sod2 ORF Vector (Rat) (pORF)

ORF076819 1.0 ug DNA
EUR 506

h SOD2 inducible lentiviral particles

LVP404 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made inducible lentiviral particles for expressing human target: SOD2 (alternative name: RP1-56L9.2, IPOB, MNSOD, MVCD6), with ORF sequence 100% matching to CDS region in NCBI ID: NM_000636.

SOD2 ORF Vector (Human) (pORF)

ORF009896 1.0 ug DNA
EUR 95

SOD2 ORF Vector (Human) (pORF)

ORF009897 1.0 ug DNA
EUR 95

Sod2 ORF Vector (Mouse) (pORF)

ORF058157 1.0 ug DNA
EUR 506

SOD2 ELISA Kit (Human) (OKAN05206)

OKAN05206 96 Wells
EUR 792
Description: Description of target: This gene is a member of the iron/manganese superoxide dismutase family. It encodes a mitochondrial protein that forms a homotetramer and binds one manganese ion per subunit. This protein binds to the superoxide byproducts of oxidative phosphorylation and converts them to hydrogen peroxide and diatomic oxygen. Mutations in this gene have been associated with idiopathic cardiomyopathy (IDC), premature aging, sporadic motor neuron disease, and cancer. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 1.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.37 ng/mL

SOD2 ELISA Kit (Rat) (OKAN05861)

OKAN05861 96 Wells
EUR 792
Description: Description of target: manganese superoxide dismutase; intramitochondrial free radical scavenging enzyme [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 14.5 pg/mL

SOD2 ELISA Kit (Rat) (OKCD00750)

OKCD00750 96 Wells
EUR 857
Description: Description of target: Destroys superoxide anion radicals which are normally produced within the cells and which are toxic to biological systems.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.5"Quantitative assessment of tyrosine nitration of manganese superoxide dismutase in angiotensin II-infused rat kidney."_x005F_x005F_x000D_Guo W., Adachi T., Matsui R., Xu S., Jiang B., Zou M.H., Kirber M., Lieberthal W., Cohen R.A._x005F_x005F_x000D_Am. J. Physiol. 285:H1396-H1403(2003) [PubMed] [Europe PMC] [Abstract]Cited for: NITRATION, FUNCTION DURING OXIDATIVE STRESS. ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 14.5 pg/mL

SOD2 ELISA Kit (Rat) (OKCA01004)

OKCA01004 96 Wells
EUR 833
Description: Description of target: Destroys superoxide anion radicals which are normally produced within the cells and which are toxic to biological systems. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.47 pg/mL

SOD2 ELISA Kit (Mouse) (OKCA02458)

OKCA02458 96 Wells
EUR 846
Description: Description of target: Destroys superoxide anion radicals which are normally produced within the cells and which are toxic to biological systems. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.156 ng/mL

SOD2 ELISA Kit (Human) (OKCD07125)

OKCD07125 96 Wells
EUR 936
Description: Description of target: SOD2 is a member of the iron/manganese superoxide dismutase family. SOD2 is a mitochondrial protein that forms a homotetramer and binds one manganese ion per subunit. This protein binds to the superoxide byproducts of oxidative phosphorylation and converts them to hydrogen peroxide and diatomic oxygen. Mutations in this gene encoding SOD2 have been associated with idiopathic cardiomyopathy (IDC), premature aging, sporadic motor neuron disease, and cancer.This gene is a member of the iron/manganese superoxide dismutase family. It encodes a mitochondrial protein that forms a homotetramer and binds one manganese ion per subunit. This protein binds to the superoxide byproducts of oxidative phosphorylation and converts them to hydrogen peroxide and diatomic oxygen. Mutations in this gene have been associated with idiopathic cardiomyopathy (IDC), premature aging, sporadic motor neuron disease, and cancer. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.37ng/mL

SOD2 ELISA Kit (Bovine) (OKEH01568)

OKEH01568 96 Wells
EUR 779
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.3 ng/mL

SOD2 ELISA Kit (Mouse) (OKEH05211)

OKEH05211 96 Wells
EUR 662
Description: Description of target: Destroys superoxide anion radicals which are normally produced within the cells and which are toxic to biological systems. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39 pg/mL

SOD2 ELISA Kit (Rat) (OKEH06462)

OKEH06462 96 Wells
EUR 662
Description: Description of target: Destroys superoxide anion radicals which are normally produced within the cells and which are toxic to biological systems.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.125U/L

SOD2 ELISA Kit (Dog) (OKEH08497)

OKEH08497 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

SOD2 ELISA Kit (Pig) (OKEH08498)

OKEH08498 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (ATTO 390)

abx447249-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (ATTO 488)

abx447250-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (ATTO 565)

abx447251-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (ATTO 594)

abx447252-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (ATTO 633)

abx447253-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (ATTO 655)

abx447254-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (ATTO 680)

abx447255-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (ATTO 700)

abx447256-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (ATTO 390)

abx446246-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (ATTO 488)

abx446247-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (ATTO 565)

abx446248-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (ATTO 594)

abx446249-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (ATTO 633)

abx446250-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Superoxide Dismutase [Mn], Mitochondrial (SOD2) Antibody (ATTO 655)

abx446251-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

SOD2 Rabbit Polyclonal Antibody