SEC22B Rabbit Polyclonal Antibody

SEC22B Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

SEC22B Polyclonal Antibody

ABP57369-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human SEC22B
  • Applications tips:
Description: A polyclonal antibody for detection of SEC22B from Human, Mouse, Rat. This SEC22B antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human SEC22B

SEC22B Polyclonal Antibody

ABP57369-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human SEC22B
  • Applications tips:
Description: A polyclonal antibody for detection of SEC22B from Human, Mouse, Rat. This SEC22B antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human SEC22B

SEC22B Polyclonal Antibody

ABP57369-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human SEC22B
  • Applications tips:
Description: A polyclonal antibody for detection of SEC22B from Human, Mouse, Rat. This SEC22B antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human SEC22B

SEC22B Polyclonal Antibody

A63398 100 µg
EUR 570.55
Description: Ask the seller for details

SEC22B Rabbit pAb

A4318-100ul 100 ul
EUR 308

SEC22B Rabbit pAb

A4318-200ul 200 ul
EUR 459

SEC22B Rabbit pAb

A4318-20ul 20 ul Ask for price

SEC22B Rabbit pAb

A4318-50ul 50 ul Ask for price

SEC22B Rabbit pAb

A15358-100ul 100 ul
EUR 308

SEC22B Rabbit pAb

A15358-200ul 200 ul
EUR 459

SEC22B Rabbit pAb

A15358-20ul 20 ul
EUR 183

SEC22B Rabbit pAb

A15358-50ul 50 ul
EUR 223

Polyclonal SEC22B Antibody (Center)

AMM07739G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SEC22B (Center). This antibody is tested and proven to work in the following applications:

Rabbit Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E04V0066-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E04V0066-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E04V0066-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SEC22B Antibody

ABD10010 100 ug
EUR 438

SEC22B Antibody

44445-100ul 100ul
EUR 252

SEC22B Antibody

44445-50ul 50ul
EUR 187

SEC22B antibody

70R-20141 50 ul
EUR 435
Description: Rabbit polyclonal SEC22B antibody

SEC22B Antibody

DF10010 200ul
EUR 304
Description: SEC22B Antibody detects endogenous levels of total SEC22B.

SEC22B Antibody

1-CSB-PA020945GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SEC22B. Recognizes SEC22B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SEC22B Antibody

1-CSB-PA020945LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC22B. Recognizes SEC22B from Human. This antibody is Unconjugated. Tested in the following application: ELISA

SEC22B Polyclonal Antibody, FITC Conjugated

A63400 100 µg
EUR 570.55
Description: kits suitable for this type of research

SEC22B Polyclonal Antibody, Biotin Conjugated

A63401 100 µg
EUR 570.55
Description: fast delivery possible

SEC22B Polyclonal Antibody, HRP Conjugated

A63399 100 µg
EUR 570.55
Description: The best epigenetics products

SEC22B Conjugated Antibody

C44445 100ul
EUR 397

anti- SEC22B antibody

FNab07679 100µg
EUR 548.75
  • Immunogen: SEC22 vesicle trafficking protein homolog B(S. cerevisiae)
  • Uniprot ID: O75396
  • Gene ID: 9554
  • Research Area: Metabolism
Description: Antibody raised against SEC22B

Anti-SEC22B antibody

PAab07679 100 ug
EUR 386

Anti-SEC22B antibody

STJ97633 200 µl
EUR 197
Description: Rabbit polyclonal to SEC22B.

Anti-SEC22B antibody

STJ25463 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the SEC22 family of vesicle trafficking proteins. It seems to complex with SNARE and it is thought to play a role in the ER-Golgi protein trafficking. This protein has strong similarity to Mus musculus and Cricetulus griseus proteins.

Anti-SEC22B antibody

STJ117553 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the SEC22 family of vesicle trafficking proteins. It seems to complex with SNARE and it is thought to play a role in the ER-Golgi protein trafficking. This protein has strong similarity to Mus musculus and Cricetulus griseus proteins.

Sec22b/ Rat Sec22b ELISA Kit

ELI-29749r 96 Tests
EUR 886

SEC22B siRNA

20-abx904839
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SEC22B siRNA

20-abx932766
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SEC22B siRNA

20-abx932767
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-SEC22B

PVT18579 2 ug
EUR 231

Anti-SEC22B/Sec22L1 Antibody

A06284 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for SEC22B Antibody (SEC22B) detection.tested for IHC, WB in Human, Mouse, Rat.

SEC22B Antibody, HRP conjugated

1-CSB-PA020945LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC22B. Recognizes SEC22B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SEC22B Antibody, FITC conjugated

1-CSB-PA020945LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC22B. Recognizes SEC22B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SEC22B Antibody, Biotin conjugated

1-CSB-PA020945LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC22B. Recognizes SEC22B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E03V0066-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E03V0066-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E03V0066-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E01V0066-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E01V0066-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E01V0066-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E02V0066-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E02V0066-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E02V0066-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E07V0066-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E07V0066-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E07V0066-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E08V0066-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E08V0066-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E08V0066-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E06V0066-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E06V0066-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E06V0066-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E09V0066-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E09V0066-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E09V0066-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Chicken Vesicle- trafficking protein SEC22b, SEC22B ELISA KIT

ELI-18428c 96 Tests
EUR 928

Human Vesicle- trafficking protein SEC22b, SEC22B ELISA KIT

ELI-29475h 96 Tests
EUR 824

Mouse Vesicle- trafficking protein SEC22b, Sec22b ELISA KIT

ELI-30509m 96 Tests
EUR 865

SEC22B cloning plasmid

CSB-CL020945HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atggtgttgctaacaatgatcgcccgagtggcggacgggctcccgctggccgcctcgatgcaggaggacgaacagtctggccgggaccttcaacagtatcagagtcaggctaagcaactctttcgaaagttgaatgaacagtcccctaccagatgtaccttggaagcaggagccat
  • Show more
Description: A cloning plasmid for the SEC22B gene.

SEC22B Blocking Peptide

DF10010-BP 1mg
EUR 195

Guinea pig Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E05V0066-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E05V0066-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Vesicle trafficking protein SEC22b(SEC22B) ELISA kit

E05V0066-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Vesicle trafficking protein SEC22b(SEC22B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat SEC22B shRNA Plasmid

20-abx989626
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SEC22B ELISA KIT|Human

EF002787 96 Tests
EUR 689

Human SEC22B shRNA Plasmid

20-abx956355
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SEC22B protein (His tag)

80R-2461 100 ug
EUR 322
Description: Purified recombinant SEC22B protein (His tag)

Mouse SEC22B shRNA Plasmid

20-abx972623
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SEC22B Recombinant Protein (Human)

RP027889 100 ug Ask for price

SEC22B Recombinant Protein (Rat)

RP227882 100 ug Ask for price

SEC22B Recombinant Protein (Mouse)

RP170540 100 ug Ask for price

SEC22B ORF Vector (Human) (pORF)

ORF009297 1.0 ug DNA
EUR 95

Sec22b ORF Vector (Mouse) (pORF)

ORF056848 1.0 ug DNA
EUR 506

Sec22b ORF Vector (Rat) (pORF)

ORF075962 1.0 ug DNA
EUR 506

SEC22 Vesicle Trafficking Protein-Like 1 (Sec22b) Antibody

20-abx115398
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

SEC22 Vesicle Trafficking Protein-Like 1 (SEC22B) Antibody

20-abx003209
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

SEC22 Vesicle Trafficking Protein-Like 1 (SEC22B) Antibody

abx027778-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SEC22 Vesicle Trafficking Protein-Like 1 (SEC22B) Antibody

abx027778-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SEC22 Vesicle Trafficking Protein-Like 1 (SEC22B) Antibody

20-abx218472
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

SEC22 Vesicle Trafficking Protein-Like 1 (SEC22B) Antibody

abx237679-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

SEC22 Vesicle Trafficking Protein-Like 1 (SEC22B) Antibody

20-abx305268
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SEC22B sgRNA CRISPR Lentivector set (Human)

K2113001 3 x 1.0 ug
EUR 339

Sec22b sgRNA CRISPR Lentivector set (Mouse)

K3317401 3 x 1.0 ug
EUR 339

Sec22b sgRNA CRISPR Lentivector set (Rat)

K7475101 3 x 1.0 ug
EUR 339

SEC22 Vesicle Trafficking Protein-Like 1 (SEC22B) Antibody (HRP)

20-abx305269
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SEC22 Vesicle Trafficking Protein-Like 1 (SEC22B) Antibody (FITC)

20-abx305270
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SEC22 Vesicle Trafficking Protein-Like 1 (SEC22B) Antibody (Biotin)

20-abx305271
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SEC22B sgRNA CRISPR Lentivector (Human) (Target 1)

K2113002 1.0 ug DNA
EUR 154

SEC22B sgRNA CRISPR Lentivector (Human) (Target 2)

K2113003 1.0 ug DNA
EUR 154

SEC22B sgRNA CRISPR Lentivector (Human) (Target 3)

K2113004 1.0 ug DNA
EUR 154

Sec22b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3317402 1.0 ug DNA
EUR 154

Sec22b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3317403 1.0 ug DNA
EUR 154

Sec22b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3317404 1.0 ug DNA
EUR 154

Sec22b sgRNA CRISPR Lentivector (Rat) (Target 1)

K7475102 1.0 ug DNA
EUR 154

Sec22b sgRNA CRISPR Lentivector (Rat) (Target 2)

K7475103 1.0 ug DNA
EUR 154

Sec22b sgRNA CRISPR Lentivector (Rat) (Target 3)

K7475104 1.0 ug DNA
EUR 154

SEC22B SEC22 Homolog B Human Recombinant Protein

PROTO75396 Regular: 20ug
EUR 317
Description: SEC22B Human Recombinant produced in E. coli is a single polypeptide chain containing 205 amino acids (14-194) and having a molecular mass of 23.3 kDa.;SEC22B is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

SEC22B Protein Vector (Human) (pPB-C-His)

PV037185 500 ng
EUR 329

SEC22B Protein Vector (Human) (pPB-N-His)

PV037186 500 ng
EUR 329

SEC22B Protein Vector (Human) (pPM-C-HA)

PV037187 500 ng
EUR 329

SEC22B Protein Vector (Human) (pPM-C-His)

PV037188 500 ng
EUR 329

Recombinant Human SEC22B Protein, His, E.coli-1mg

QP13446-1mg 1mg
EUR 2757

Recombinant Human SEC22B Protein, His, E.coli-20ug

QP13446-20ug 20ug
EUR 201

Recombinant Human SEC22B Protein, His, E.coli-5ug

QP13446-5ug 5ug
EUR 155

SEC22B Protein Vector (Rat) (pPB-C-His)

PV303846 500 ng
EUR 603

SEC22B Protein Vector (Rat) (pPB-N-His)

PV303847 500 ng
EUR 603

SEC22B Protein Vector (Rat) (pPM-C-HA)

PV303848 500 ng
EUR 603

SEC22B Protein Vector (Rat) (pPM-C-His)

PV303849 500 ng
EUR 603

SEC22B Protein Vector (Mouse) (pPB-C-His)

PV227390 500 ng
EUR 603

SEC22B Protein Vector (Mouse) (pPB-N-His)

PV227391 500 ng
EUR 603

SEC22B Protein Vector (Mouse) (pPM-C-HA)

PV227392 500 ng
EUR 603

SEC22B Protein Vector (Mouse) (pPM-C-His)

PV227393 500 ng
EUR 603

Sec22b 3'UTR GFP Stable Cell Line

TU168495 1.0 ml Ask for price

SEC22B 3'UTR Luciferase Stable Cell Line

TU022833 1.0 ml
EUR 1394

Sec22b 3'UTR Luciferase Stable Cell Line

TU118495 1.0 ml Ask for price

SEC22B 3'UTR GFP Stable Cell Line

TU072833 1.0 ml
EUR 1394

Sec22b 3'UTR Luciferase Stable Cell Line

TU220058 1.0 ml Ask for price

Sec22b 3'UTR GFP Stable Cell Line

TU270058 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

SEC22B Rabbit Polyclonal Antibody