PRX I Rabbit Polyclonal Antibody

PRX I Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

PRX I Polyclonal Antibody
41828-50ul 50ul
EUR 187
PRX I Polyclonal Antibody
ABP53186-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human PRX I
  • Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX I
PRX I Polyclonal Antibody
ABP53186-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human PRX I
  • Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX I
PRX I Polyclonal Antibody
ABP53186-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human PRX I
  • Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX I
PRX I Polyclonal Antibody
ABP57178-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
PRX I Polyclonal Antibody
ABP57178-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
PRX I Polyclonal Antibody
ABP57178-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of PRX I from Human, Mouse, Rat. This PRX I antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
PRX I Polyclonal Antibody
ES8177-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PRX I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
PRX I Polyclonal Antibody
ES8177-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PRX I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
PRX I Polyclonal Antibody
ES4185-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PRX I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
PRX I Polyclonal Antibody
ES4185-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PRX I from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
PRX I Polyclonal Conjugated Antibody
C41828 100ul
EUR 397
Anti-PRX I antibody
STJ96820 200 µl
EUR 197
Description: Rabbit polyclonal to PRX I.
Anti-PRX I antibody
STJ97366 200 µl
EUR 197
Description: Rabbit polyclonal to PRX I.
PRX Polyclonal Antibody
30158-100ul 100ul
EUR 252
PRX Polyclonal Antibody
30158-50ul 50ul
EUR 187
PRX Rabbit pAb
A17744-100ul 100 ul
EUR 308
PRX Rabbit pAb
A17744-200ul 200 ul
EUR 459
PRX Rabbit pAb
A17744-20ul 20 ul
EUR 183
PRX Rabbit pAb
A17744-50ul 50 ul
EUR 223
PRX III Polyclonal Antibody
41363-100ul 100ul
EUR 252
PRX III Polyclonal Antibody
41363-50ul 50ul
EUR 187
PRX Polyclonal Conjugated Antibody
C30158 100ul
EUR 397
PRX III Polyclonal Antibody
ABP52267-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human PRX III
  • Applications tips:
Description: A polyclonal antibody for detection of PRX III from Human, Mouse, Rat. This PRX III antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX III
PRX III Polyclonal Antibody
ABP52267-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human PRX III
  • Applications tips:
Description: A polyclonal antibody for detection of PRX III from Human, Mouse, Rat. This PRX III antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX III
PRX III Polyclonal Antibody
ABP52267-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human PRX III
  • Applications tips:
Description: A polyclonal antibody for detection of PRX III from Human, Mouse, Rat. This PRX III antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PRX III
PRX II Polyclonal Antibody
ABP56362-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human PRX II
  • Applications tips:
Description: A polyclonal antibody for detection of PRX II from Human, Mouse, Rat. This PRX II antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRX II
PRX II Polyclonal Antibody
ABP56362-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human PRX II
  • Applications tips:
Description: A polyclonal antibody for detection of PRX II from Human, Mouse, Rat. This PRX II antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRX II
PRX II Polyclonal Antibody
ABP56362-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human PRX II
  • Applications tips:
Description: A polyclonal antibody for detection of PRX II from Human, Mouse, Rat. This PRX II antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRX II
PRX II Polyclonal Antibody
ES7361-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PRX II from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
PRX II Polyclonal Antibody
ES7361-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PRX II from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
PRX III Polyclonal Antibody
ES3266-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PRX III from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
PRX III Polyclonal Antibody
ES3266-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PRX III from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
PRX Antibody
1-CSB-PA018656GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PRX. Recognizes PRX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
PRX III Polyclonal Conjugated Antibody
C41363 100ul
EUR 397
Prx III antibody
70R-21656 50 ul
EUR 435
Description: Rabbit polyclonal Prx III antibody
Anti-PRX Antibody
A01686 100ug/vial
EUR 334
Anti-PRX antibody
STJ119785 100 µl
EUR 277
Description: This gene encodes a protein involved in peripheral nerve myelin upkeep. The encoded protein contains 2 PDZ domains which were named after PSD95 (post synaptic density protein), DlgA (Drosophila disc large tumor suppressor), and ZO1 (a mammalian tight junction protein). Two alternatively spliced transcript variants have been described for this gene which encode different protein isoforms and which are targeted differently in the Schwann cell. Mutations in this gene cause Charcot-Marie-Tooth neuoropathy, type 4F and Dejerine-Sottas neuropathy. [provided by RefSeq, Jul 2008]
IGF-I Polyclonal Antibody (Rabbit)
PABCa 1 mg
EUR 299
Prx/ Rat Prx ELISA Kit
ELI-19663r 96 Tests
EUR 886
Human Kinase Library I
HKIN-I 1 set
EUR 450
Human Drug Detoxication I
HDTX-I 1 set
EUR 548
PRX-08066
B1200-5 5 mg
EUR 448
Description: PRX-08066 is a selective antagonist of 5-hydroxytryptamine receptor 2B (5-HT2BR) with Ki value of 3.4nM [1].PRX-08066 is found to causes selective vasodilation of pulmonary arteries and is developed to treat for pulmonary arterial hypertension (PAH).
PRX siRNA
20-abx904297
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PRX siRNA
20-abx930081
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PRX siRNA
20-abx930082
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PRX-08066
HY-15472 5mg
EUR 291
Human Cytokine Primer Library I
HCA-I 1 set
EUR 450
Mouse Cytokine Primer Library I
MCA-I 1 set
EUR 450
Rat Cytokine Primer Library I
RCA-I 1 set
EUR 548
Rabbit Anti Rig-I Polyclonal Antibody
CPBT-65259RR 0.1 mg
EUR 663
Human IGF-I Polyclonal Antibody (Rabbit)
PAA2 400 µg
EUR 299
Anti-PRX II antibody
STJ95237 200 µl
EUR 197
Description: Rabbit polyclonal to PRX II.
Anti-PRX III antibody
STJ95238 200 µl
EUR 197
Description: Rabbit polyclonal to PRX III.
Human Colon Cancer Primer Library I
HCCP-I 1 set
EUR 548
Human DNA Repair Primer Library I
HDRL-I 1 set
EUR 548
Human Drug Transporter I Primer Library
HDTP-I 1 set
EUR 548
Mouse DNA Repair Primer Library I
MDRL-I 1 set
EUR 645
Polyclonal Rabbit anti-Troponin I
TnI 50 uL
EUR 280
Human Interferon Type I Signaling Primer Library
HIFN-I 1 set
EUR 548
Human Cancer Driver Gene I Primer Library
HCDG-I 1 set
EUR 645
Rabbit Anti-Complement Factor I Polyclonal Antibody
CTA-335-100ug 100ug Ask for price
Description: Rabbit anti-complement Factor I polyclonal antibodyfor WB, IHC, IHC-P.
Rabbit Anti-Complement Factor I Polyclonal Antibody
CTA-335-1mg 1mg Ask for price
Description: Rabbit anti-complement Factor I polyclonal antibodyfor WB, IHC, IHC-P.
Rabbit Anti Human I-Tac Polyclonal Antibody
CPBT-65168RH 0.1 mg
EUR 881
Rabbit Anti Chicken Collagen I Polyclonal Antibody
CPBT-67349RC 0.5 ml
EUR 861
Rabbit Anti Human Annexin I Polyclonal Antibody
CPBT-67390RH 0.1 mg
EUR 767
Rabbit Anti Human Collagen I Polyclonal Antibody
CPBT-67896RH 50 µg
EUR 944
Rabbit Anti Rat Collagen I Polyclonal Antibody
CPBT-67923RR 0.5 ml
EUR 767
Rabbit Anti Mouse Collagen I Polyclonal Antibody
CPBT-68065RM 0.1 ml
EUR 840
PRX cloning plasmid
CSB-CL018833HU-10ug 10ug
EUR 1715
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4386
  • Sequence: atggaggccaggagccggagtgccgaggagctgaggcgggcggagttggtggaaattatcgtggagacggaggcgcagaccggggtcagcggcatcaacgtagcgggcggcggcaaagagggaatcttcgttcgggagctgcgcgaggactcacccgccgccaggagcctcagcc
  • Show more
Description: A cloning plasmid for the PRX gene.
Rabbit Polyclonal Antibody to Human Topoisomerase I (Rabbit Serum)
TG2012-2 250 ul
EUR 380
Rabbit Anti Phap I (C-Terminal) Polyclonal Antibody
CPBT-66414RP 0.1 mg
EUR 663
Rabbit Anti Bovine Collagen I/Iii Polyclonal Antibody
CPBT-67295RB 0.5 ml
EUR 767
Rabbit Anti Dog Collagen I/Iii Polyclonal Antibody
CPBT-67318RD 0.5 ml
EUR 767
Rabbit Anti Human Collagen I/Iii Polyclonal Antibody
CPBT-67898RH 0.5 ml
EUR 767
Human PRX ELISA Kit
ELA-E13230h 96 Tests
EUR 824
PRX ELISA KIT|Human
EF005289 96 Tests
EUR 689
Mouse PRX shRNA Plasmid
20-abx972229
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat PRX shRNA Plasmid
20-abx986471
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human PRX shRNA Plasmid
20-abx961655
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PRX-08066 Maleic acid
A2098-10 10 mg
EUR 608
Description: PRX-08066 Maleic acid is a selective 5-hydroxytryptamine receptor 2B (5-HT2BR) antagonist [1].
PRX-08066 Maleic acid
A2098-5 5 mg
EUR 457
Description: PRX-08066 Maleic acid is a selective 5-hydroxytryptamine receptor 2B (5-HT2BR) antagonist [1].
PRX-08066 Maleic acid
A2098-5.1 10 mM (in 1mL DMSO)
EUR 893
Description: PRX-08066 Maleic acid is a selective 5-hydroxytryptamine receptor 2B (5-HT2BR) antagonist [1].
Collagen I Polyclonal Antibody
46888-100ul 100ul
EUR 252
Collagen I Polyclonal Antibody
46888-50ul 50ul
EUR 187
HXK I Polyclonal Antibody
41049-100ul 100ul
EUR 252
HXK I Polyclonal Antibody
41049-50ul 50ul
EUR 187
Synapsin I Polyclonal Antibody
41470-100ul 100ul
EUR 252
Synapsin I Polyclonal Antibody
41470-50ul 50ul
EUR 187
ApoA-I Polyclonal Antibody
41817-100ul 100ul
EUR 252
ApoA-I Polyclonal Antibody
41817-50ul 50ul
EUR 187
ANG I Polyclonal Antibody
41909-100ul 100ul
EUR 252
ANG I Polyclonal Antibody
41909-50ul 50ul
EUR 187
I-FABP Polyclonal Antibody
46763-100ul 100ul
EUR 252
I-FABP Polyclonal Antibody
46763-50ul 50ul
EUR 187
ANG I Polyclonal Antibody
46795-100ul 100ul
EUR 252
ANG I Polyclonal Antibody
46795-50ul 50ul
EUR 187
Annexin I Polyclonal Antibody
40590-100ul 100ul
EUR 252
Annexin I Polyclonal Antibody
40590-50ul 50ul
EUR 187
Annexin I Polyclonal Antibody
40591-100ul 100ul
EUR 252
Annexin I Polyclonal Antibody
40591-50ul 50ul
EUR 187
Polyclonal Synaptotagmin I Antibody
APG00323G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Synaptotagmin I . This antibody is tested and proven to work in the following applications:
Polyclonal IGF-I Antibody
APR00268G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IGF-I . This antibody is tested and proven to work in the following applications:
Polyclonal Synaptotagmin-I Antibody
AMM08056G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Synaptotagmin-I . This antibody is tested and proven to work in the following applications:
I?B-? Polyclonal Antibody
ABP55388-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22
  • Applications tips:
Description: A polyclonal antibody for detection of I?B-? from Human, Mouse, Rat. This I?B-? antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22
I?B-? Polyclonal Antibody
ABP55388-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22
  • Applications tips:
Description: A polyclonal antibody for detection of I?B-? from Human, Mouse, Rat. This I?B-? antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22
I?B-? Polyclonal Antibody
ABP55388-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22
  • Applications tips:
Description: A polyclonal antibody for detection of I?B-? from Human, Mouse, Rat. This I?B-? antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human I?B-? around the non-phosphorylation site of S22
Neurophysin I Polyclonal Antibody
ABP55453-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurophysin I
  • Applications tips:
Description: A polyclonal antibody for detection of Neurophysin I from Human, Rat. This Neurophysin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurophysin I
Neurophysin I Polyclonal Antibody
ABP55453-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurophysin I
  • Applications tips:
Description: A polyclonal antibody for detection of Neurophysin I from Human, Rat. This Neurophysin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurophysin I
Neurophysin I Polyclonal Antibody
ABP55453-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurophysin I
  • Applications tips:
Description: A polyclonal antibody for detection of Neurophysin I from Human, Rat. This Neurophysin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurophysin I
Collagen I Polyclonal Antibody
ABP58229-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542
  • Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542
Collagen I Polyclonal Antibody
ABP58229-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542
  • Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542
Collagen I Polyclonal Antibody
ABP58229-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542
  • Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Collagen I protein at amino acid sequence of 468-542
Collagen I Polyclonal Antibody
ABP58230-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human Collagen I protein
  • Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Collagen I protein
Collagen I Polyclonal Antibody
ABP58230-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human Collagen I protein
  • Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Collagen I protein
Collagen I Polyclonal Antibody
ABP58230-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human Collagen I protein
  • Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Collagen I protein
I?B ? Polyclonal Antibody
EA213-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against I?B ? from Human/ Rat. This antibody is tested and validated for WB, ELISA, IHC
I?B ? Polyclonal Antibody
EA213-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against I?B ? from Human/ Rat. This antibody is tested and validated for WB, ELISA, IHC
Polyclonal Synapsin I Antibody
APR13608G 0.1mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Synapsin I . This antibody is tested and proven to work in the following applications:
Polyclonal Synapsin I Antibody
APR13609G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Synapsin I . This antibody is tested and proven to work in the following applications:
Polyclonal Synapsin I Antibody
APR13610G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Synapsin I . This antibody is tested and proven to work in the following applications:
Polyclonal IGF-I Antibody
APR07952G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IGF-I . This antibody is tested and proven to work in the following applications:
Polyclonal PHAP I Antibody
APR09079G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PHAP I . This antibody is tested and proven to work in the following applications:
Polyclonal PHAP I Antibody
APR09080G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PHAP I . This antibody is tested and proven to work in the following applications:
Dynamin I Polyclonal Antibody
ABP54012-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S778
  • Applications tips:
Description: A polyclonal antibody for detection of Dynamin I from Human, Mouse, Rat. This Dynamin I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S778
Dynamin I Polyclonal Antibody
ABP54012-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S778
  • Applications tips:
Description: A polyclonal antibody for detection of Dynamin I from Human, Mouse, Rat. This Dynamin I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S778
Dynamin I Polyclonal Antibody
ABP54012-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S778
  • Applications tips:
Description: A polyclonal antibody for detection of Dynamin I from Human, Mouse, Rat. This Dynamin I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S778
Synapsin I Polyclonal Antibody
ABP52532-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9
  • Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9
Synapsin I Polyclonal Antibody
ABP52532-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9
  • Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9
Synapsin I Polyclonal Antibody
ABP52532-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9
  • Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S9
ApoA-I Polyclonal Antibody
ABP53170-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human ApoA-I
  • Applications tips:
Description: A polyclonal antibody for detection of ApoA-I from Human, Mouse. This ApoA-I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ApoA-I
ApoA-I Polyclonal Antibody
ABP53170-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human ApoA-I
  • Applications tips:
Description: A polyclonal antibody for detection of ApoA-I from Human, Mouse. This ApoA-I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ApoA-I
ApoA-I Polyclonal Antibody
ABP53170-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ApoA-I
  • Applications tips:
Description: A polyclonal antibody for detection of ApoA-I from Human, Mouse. This ApoA-I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ApoA-I
ANG I Polyclonal Antibody
ABP53274-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human ANG I
  • Applications tips:
Description: A polyclonal antibody for detection of ANG I from Human. This ANG I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human ANG I
ANG I Polyclonal Antibody
ABP53274-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human ANG I
  • Applications tips:
Description: A polyclonal antibody for detection of ANG I from Human. This ANG I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human ANG I
ANG I Polyclonal Antibody
ABP53274-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human ANG I
  • Applications tips:
Description: A polyclonal antibody for detection of ANG I from Human. This ANG I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human ANG I
Dynamin I Polyclonal Antibody
ABP51209-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S774
  • Applications tips:
Description: A polyclonal antibody for detection of Dynamin I from Human, Mouse, Rat. This Dynamin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S774
Dynamin I Polyclonal Antibody
ABP51209-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S774
  • Applications tips:
Description: A polyclonal antibody for detection of Dynamin I from Human, Mouse, Rat. This Dynamin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S774
Dynamin I Polyclonal Antibody
ABP51209-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S774
  • Applications tips:
Description: A polyclonal antibody for detection of Dynamin I from Human, Mouse, Rat. This Dynamin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Dynamin I around the non-phosphorylation site of S774
HXK I Polyclonal Antibody
ABP51588-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human HXK I at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of HXK I from Human, Mouse, Rat. This HXK I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human HXK I at AA range: 1-80
HXK I Polyclonal Antibody
ABP51588-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human HXK I at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of HXK I from Human, Mouse, Rat. This HXK I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human HXK I at AA range: 1-80
HXK I Polyclonal Antibody
ABP51588-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human HXK I at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of HXK I from Human, Mouse, Rat. This HXK I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human HXK I at AA range: 1-80
Synapsin I Polyclonal Antibody
ABP-PAB-22036 100 ug Ask for price
    • Product line: Pan-specific Antibodies
    • Brand:
Amphiphysin I Polyclonal Antibody
ABP50648-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Amphiphysin I at AA range: 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of Amphiphysin I from Human, Mouse, Rat. This Amphiphysin I antibody is for WB , ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Amphiphysin I at AA range: 100-180
Amphiphysin I Polyclonal Antibody
ABP50648-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Amphiphysin I at AA range: 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of Amphiphysin I from Human, Mouse, Rat. This Amphiphysin I antibody is for WB , ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Amphiphysin I at AA range: 100-180
Amphiphysin I Polyclonal Antibody
ABP50648-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Amphiphysin I at AA range: 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of Amphiphysin I from Human, Mouse, Rat. This Amphiphysin I antibody is for WB , ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Amphiphysin I at AA range: 100-180
Annexin I Polyclonal Antibody
ABP50656-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Annexin I
  • Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human, Mouse, Rat. This Annexin I antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Annexin I
Annexin I Polyclonal Antibody
ABP50656-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Annexin I
  • Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human, Mouse, Rat. This Annexin I antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Annexin I
Annexin I Polyclonal Antibody
ABP50656-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Annexin I
  • Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human, Mouse, Rat. This Annexin I antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Annexin I
Arylsulfatase I Polyclonal Antibody
ABP50712-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Arylsulfatase I at AA range: 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of Arylsulfatase I from Human, Monkey. This Arylsulfatase I antibody is for WB , IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Arylsulfatase I at AA range: 280-360
Arylsulfatase I Polyclonal Antibody
ABP50712-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Arylsulfatase I at AA range: 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of Arylsulfatase I from Human, Monkey. This Arylsulfatase I antibody is for WB , IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Arylsulfatase I at AA range: 280-360
Arylsulfatase I Polyclonal Antibody
ABP50712-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Arylsulfatase I at AA range: 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of Arylsulfatase I from Human, Monkey. This Arylsulfatase I antibody is for WB , IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Arylsulfatase I at AA range: 280-360
GnRH I Polyclonal Antibody
ABP54571-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human GnRH I
  • Applications tips:
Description: A polyclonal antibody for detection of GnRH I from Human. This GnRH I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GnRH I
GnRH I Polyclonal Antibody
ABP54571-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human GnRH I
  • Applications tips:
Description: A polyclonal antibody for detection of GnRH I from Human. This GnRH I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GnRH I
GnRH I Polyclonal Antibody
ABP54571-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human GnRH I
  • Applications tips:
Description: A polyclonal antibody for detection of GnRH I from Human. This GnRH I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GnRH I
Annexin I Polyclonal Antibody
ABP54713-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Annexin I around the non-phosphorylation site of Y21
  • Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human. This Annexin I antibody is for WB, IF, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Annexin I around the non-phosphorylation site of Y21
Annexin I Polyclonal Antibody
ABP54713-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Annexin I around the non-phosphorylation site of Y21
  • Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human. This Annexin I antibody is for WB, IF, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Annexin I around the non-phosphorylation site of Y21
Annexin I Polyclonal Antibody
ABP54713-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Annexin I around the non-phosphorylation site of Y21
  • Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human. This Annexin I antibody is for WB, IF, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Annexin I around the non-phosphorylation site of Y21
Factor I Polyclonal Antibody
ABP54826-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Factor I at AA rangle: 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of Factor I from Human. This Factor I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Factor I at AA rangle: 410-490
Factor I Polyclonal Antibody
ABP54826-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Factor I at AA rangle: 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of Factor I from Human. This Factor I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Factor I at AA rangle: 410-490
Factor I Polyclonal Antibody
ABP54826-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Factor I at AA rangle: 410-490
  • Applications tips:
Description: A polyclonal antibody for detection of Factor I from Human. This Factor I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Factor I at AA rangle: 410-490
IGF-I Polyclonal Antibody
ABP54846-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human IGF-I
  • Applications tips:
Description: A polyclonal antibody for detection of IGF-I from Human, Mouse, Rat. This IGF-I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IGF-I
IGF-I Polyclonal Antibody
ABP54846-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human IGF-I
  • Applications tips:
Description: A polyclonal antibody for detection of IGF-I from Human, Mouse, Rat. This IGF-I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IGF-I
IGF-I Polyclonal Antibody
ABP54846-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human IGF-I
  • Applications tips:
Description: A polyclonal antibody for detection of IGF-I from Human, Mouse, Rat. This IGF-I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human IGF-I
IP3R-I Polyclonal Antibody
ABP54966-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1598
  • Applications tips:
Description: A polyclonal antibody for detection of IP3R-I from Human, Mouse, Rat. This IP3R-I antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1598
IP3R-I Polyclonal Antibody
ABP54966-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1598
  • Applications tips:
Description: A polyclonal antibody for detection of IP3R-I from Human, Mouse, Rat. This IP3R-I antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1598
IP3R-I Polyclonal Antibody
ABP54966-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1598
  • Applications tips:
Description: A polyclonal antibody for detection of IP3R-I from Human, Mouse, Rat. This IP3R-I antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1598
Arginase I Polyclonal Antibody
ABP55029-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Arginase I at AA rangle: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of Arginase I from Human. This Arginase I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Arginase I at AA rangle: 30-110
Arginase I Polyclonal Antibody
ABP55029-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Arginase I at AA rangle: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of Arginase I from Human. This Arginase I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Arginase I at AA rangle: 30-110
Arginase I Polyclonal Antibody
ABP55029-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Arginase I at AA rangle: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of Arginase I from Human. This Arginase I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Arginase I at AA rangle: 30-110
IP3R-I Polyclonal Antibody
ABP57355-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764
  • Applications tips:
Description: A polyclonal antibody for detection of IP3R-I from Human, Mouse, Rat. This IP3R-I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764
IP3R-I Polyclonal Antibody
ABP57355-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764
  • Applications tips:
Description: A polyclonal antibody for detection of IP3R-I from Human, Mouse, Rat. This IP3R-I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764
IP3R-I Polyclonal Antibody
ABP57355-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764
  • Applications tips:
Description: A polyclonal antibody for detection of IP3R-I from Human, Mouse, Rat. This IP3R-I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human IP3R-I around the non-phosphorylation site of S1764
Collagen I Polyclonal Antibody
ABP57494-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from Collagen I at AA range: 1200-1217
  • Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from Collagen I at AA range: 1200-1217
Collagen I Polyclonal Antibody
ABP57494-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from Collagen I at AA range: 1200-1217
  • Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from Collagen I at AA range: 1200-1217
Collagen I Polyclonal Antibody
ABP57494-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from Collagen I at AA range: 1200-1217
  • Applications tips:
Description: A polyclonal antibody for detection of Collagen I from Human, Mouse, Rat. This Collagen I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from Collagen I at AA range: 1200-1217
ANG I Polyclonal Antibody
ABP57761-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60
  • Applications tips:
Description: A polyclonal antibody for detection of ANG I from Human. This ANG I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60
ANG I Polyclonal Antibody
ABP57761-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60
  • Applications tips:
Description: A polyclonal antibody for detection of ANG I from Human. This ANG I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60
ANG I Polyclonal Antibody
ABP57761-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60
  • Applications tips:
Description: A polyclonal antibody for detection of ANG I from Human. This ANG I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ANG I protein at amino acid sequence of 20-60
Annexin I Polyclonal Antibody
ABP57766-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180
  • Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human. This Annexin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180
Annexin I Polyclonal Antibody
ABP57766-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180
  • Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human. This Annexin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180
Annexin I Polyclonal Antibody
ABP57766-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180
  • Applications tips:
Description: A polyclonal antibody for detection of Annexin I from Human. This Annexin I antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human Annexin I protein at amino acid sequence of 130-180
Synapsin I Polyclonal Antibody
ABP56327-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S605
  • Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S605
Synapsin I Polyclonal Antibody
ABP56327-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S605
  • Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S605
Synapsin I Polyclonal Antibody
ABP56327-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S605
  • Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S605
Synapsin I Polyclonal Antibody
ABP56328-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S62
  • Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S62
Synapsin I Polyclonal Antibody
ABP56328-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S62
  • Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S62
Synapsin I Polyclonal Antibody
ABP56328-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S62
  • Applications tips:
Description: A polyclonal antibody for detection of Synapsin I from Human, Mouse, Rat. This Synapsin I antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Synapsin I around the non-phosphorylation site of S62
Topo I Polyclonal Antibody
ABP56413-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Topo I
  • Applications tips:
Description: A polyclonal antibody for detection of Topo I from Human, Mouse, Rat. This Topo I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Topo I
Topo I Polyclonal Antibody
ABP56413-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Topo I
  • Applications tips:
Description: A polyclonal antibody for detection of Topo I from Human, Mouse, Rat. This Topo I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Topo I
Topo I Polyclonal Antibody
ABP56413-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Topo I
  • Applications tips:
Description: A polyclonal antibody for detection of Topo I from Human, Mouse, Rat. This Topo I antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Topo I
TTF-I Polyclonal Antibody
ABP56458-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human TTF-I at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of TTF-I from Human. This TTF-I antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human TTF-I at AA range: 10-90

PRX I Rabbit Polyclonal Antibody