MPP1 Rabbit Polyclonal Antibody

MPP1 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

MPP1 Polyclonal Antibody
ES8068-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MPP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
MPP1 Polyclonal Antibody
ABP57069-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human MPP1 at AA range: 1740-1820
  • Applications tips:
Description: A polyclonal antibody for detection of MPP1 from Human. This MPP1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human MPP1 at AA range: 1740-1820
MPP1 Polyclonal Antibody
ABP57069-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human MPP1 at AA range: 1740-1820
  • Applications tips:
Description: A polyclonal antibody for detection of MPP1 from Human. This MPP1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human MPP1 at AA range: 1740-1820
MPP1 Polyclonal Antibody
ABP57069-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human MPP1 at AA range: 1740-1820
  • Applications tips:
Description: A polyclonal antibody for detection of MPP1 from Human. This MPP1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human MPP1 at AA range: 1740-1820
MPP1 Rabbit pAb
A6298-100ul 100 ul
EUR 308
MPP1 Rabbit pAb
A6298-200ul 200 ul
EUR 459
MPP1 Rabbit pAb
A6298-20ul 20 ul
EUR 183
MPP1 Rabbit pAb
A6298-50ul 50 ul
EUR 223
Polyclonal MPP1 Antibody (Center)
APR03467G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MPP1 (Center). This antibody is tested and proven to work in the following applications:
MPP1 Antibody
AF9115 200ul
EUR 304
Description: MPP1 Antibody detects endogenous levels of total MPP1.
MPP1 Antibody
ABF9115 100 ug
EUR 438
MPP1 Antibody
ABD8276 100 ug
EUR 438
MPP1 Antibody
ABD8320 100 ug
EUR 438
MPP1 antibody
38804-100ul 100ul
EUR 252
MPP1 antibody
22186-100ul 100ul
EUR 390
MPP1 antibody
22187-100ul 100ul
EUR 390
MPP1 antibody
70R-18577 50 ul
EUR 435
Description: Rabbit polyclonal MPP1 antibody
MPP1 antibody
70R-13421 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal MPP1 antibody
MPP1 antibody
70R-13443 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal MPP1 antibody
MPP1 Antibody
DF8276 200ul
EUR 304
Description: MPP1 Antibody detects endogenous levels of total MPP1.
MPP1 Antibody
1-CSB-PA014758GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MPP1. Recognizes MPP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
MPP1 Antibody
1-CSB-PA014758LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPP1. Recognizes MPP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
MPP1 Conjugated Antibody
C38804 100ul
EUR 397
anti- MPP1 antibody
FNab05287 100µg
EUR 548.75
  • Immunogen: membrane protein, palmitoylated 1, 55kDa
  • Uniprot ID: Q00013
  • Gene ID: 4354
  • Research Area: Neuroscience, Cardiovascular, Metabolism, Signal Transduction
Description: Antibody raised against MPP1
Anti-MPP1 Antibody
PB10078 100ug/vial
EUR 294
Anti-MPP1 antibody
PAab05287 100 ug
EUR 386
Anti-MPP1 antibody
STJ94188 200 µl
EUR 197
Description: Rabbit polyclonal to MPP1.
Anti-MPP1 antibody
STJ28220 100 µl
EUR 277
Description: This gene encodes the prototype of the membrane-associated guanylate kinase (MAGUK) family proteins. MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intercellular junctions. The encoded protein is an extensively palmitoylated membrane phosphoprotein containing a PDZ domain, a Src homology 3 (SH3) motif, and a guanylate kinase domain. This gene product interacts with various cytoskeletal proteins and cell junctional proteins in different tissue and cell types, and may be involved in the regulation of cell shape, hair cell development, neural patterning of the retina, and apico-basal polarity and tumor suppression pathways in non-erythroid cells. Multiple transcript variants encoding different isoforms have been found for this gene.
MPP1 siRNA
20-abx924464
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MPP1 siRNA
20-abx924465
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pOTB7-MPP1
PVT18411 2 ug
EUR 231
anti-MPP1
YF-PA13224 50 ul
EUR 363
Description: Mouse polyclonal to MPP1
anti-MPP1
YF-PA13225 50 ug
EUR 363
Description: Mouse polyclonal to MPP1
anti-MPP1
YF-PA13226 100 ug
EUR 403
Description: Rabbit polyclonal to MPP1
anti-MPP1
YF-PA24165 50 ul
EUR 334
Description: Mouse polyclonal to MPP1
anti-MPP1
YF-PA24166 50 ul
EUR 334
Description: Mouse polyclonal to MPP1
Anti-MPP1/KIF20B Antibody
A08340 100ug/vial
EUR 294
MPP1 Antibody, HRP conjugated
1-CSB-PA014758LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPP1. Recognizes MPP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
MPP1 Antibody, FITC conjugated
1-CSB-PA014758LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPP1. Recognizes MPP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
MPP1 Antibody, Biotin conjugated
1-CSB-PA014758LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPP1. Recognizes MPP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
MPP1 Blocking Peptide
AF9115-BP 1mg
EUR 195
MPP1 cloning plasmid
CSB-CL014758HU-10ug 10ug
EUR 502
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1401
  • Sequence: atgaccctcaaggcgagcgagggcgagagtgggggcagcatgcacacggcgctctccgacctctacctggagcatttgctgcagaagcgtagtcggccagaggctgtatcgcatccattgaatactgtgaccgaggacatgtacaccaacgggtctcctgccccaggtagccctg
  • Show more
Description: A cloning plasmid for the MPP1 gene.
MPP1 Blocking Peptide
DF8276-BP 1mg
EUR 195
pENTR223-MPP1-A1247G
PVT12216 2 ug
EUR 391
Anti-MPP1 (2E5)
YF-MA14277 100 ug
EUR 363
Description: Mouse monoclonal to MPP1
Membrane Protein, Palmitoylated 1 (MPP1) Antibody
20-abx113675
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Membrane Protein, Palmitoylated 1 (MPP1) Antibody
20-abx141503
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Membrane Protein, Palmitoylated 1 (MPP1) Antibody
abx145993-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Membrane Protein, Palmitoylated 1 (MPP1) Antibody
abx025862-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Membrane Protein, Palmitoylated 1 (MPP1) Antibody
abx025862-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Membrane Protein, Palmitoylated 1 (MPP1) Antibody
20-abx004813
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Membrane Protein, Palmitoylated 1 (MPP1) Antibody
20-abx333936
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Membrane Protein, Palmitoylated 1 (MPP1) Antibody
abx235287-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
MPP1 ELISA KIT|Human
EF000864 96 Tests
EUR 689
Human MPP1 shRNA Plasmid
20-abx952957
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse MPP1 shRNA Plasmid
20-abx971560
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
MPP1 Recombinant Protein (Human)
RP019774 100 ug Ask for price
MPP1 Recombinant Protein (Mouse)
RP151268 100 ug Ask for price
Anti-MPP1 (1E11-1G11)
YF-MA14275 100 ug
EUR 363
Description: Mouse monoclonal to MPP1
Anti-MPP1 (1C3-1D11)
YF-MA14276 100 ug
EUR 363
Description: Mouse monoclonal to MPP1
Rabbit 55 kDa erythrocyte membrane protein(MPP1) ELISA kit
E04M0447-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit 55 kDa erythrocyte membrane protein(MPP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 55 kDa erythrocyte membrane protein(MPP1) ELISA kit
E04M0447-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit 55 kDa erythrocyte membrane protein(MPP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 55 kDa erythrocyte membrane protein(MPP1) ELISA kit
E04M0447-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit 55 kDa erythrocyte membrane protein(MPP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Membrane Protein, Palmitoylated 1 (MPP1) Antibody (HRP)
20-abx334494
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Membrane Protein, Palmitoylated 1 (MPP1) Antibody (FITC)
20-abx334495
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Membrane Protein, Palmitoylated 1 (MPP1) Antibody (Biotin)
20-abx334496
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
MPP1 ORF Vector (Human) (pORF)
ORF006592 1.0 ug DNA
EUR 95
Mpp1 ORF Vector (Mouse) (pORF)
ORF050424 1.0 ug DNA
EUR 506
Monoclonal MPP1 Antibody (monoclonal) (M01), Clone: 1E11-1G11
AMM03808G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human MPP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1E11-1G11. This antibody is applicable in WB and IF, IP, E
Monoclonal MPP1 Antibody (monoclonal) (M02), Clone: 1C3-1D11
AMM03809G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human MPP1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1C3-1D11. This antibody is applicable in WB, E
MPP1 sgRNA CRISPR Lentivector set (Human)
K1320901 3 x 1.0 ug
EUR 339
Mpp1 sgRNA CRISPR Lentivector set (Mouse)
K3424301 3 x 1.0 ug
EUR 339
MPP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1320902 1.0 ug DNA
EUR 154
MPP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1320903 1.0 ug DNA
EUR 154
MPP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1320904 1.0 ug DNA
EUR 154
Mpp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3424302 1.0 ug DNA
EUR 154
Mpp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3424303 1.0 ug DNA
EUR 154
Mpp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3424304 1.0 ug DNA
EUR 154
MPP1 Protein Vector (Human) (pPB-C-His)
PV026365 500 ng
EUR 329
MPP1 Protein Vector (Human) (pPB-N-His)
PV026366 500 ng
EUR 329
MPP1 Protein Vector (Human) (pPM-C-HA)
PV026367 500 ng
EUR 329
MPP1 Protein Vector (Human) (pPM-C-His)
PV026368 500 ng
EUR 329
MPP1 Protein Vector (Mouse) (pPB-C-His)
PV201694 500 ng
EUR 603

MPP1 Rabbit Polyclonal Antibody