MIB1 Rabbit Polyclonal Antibody

MIB1 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

MIB1 Polyclonal Antibody
ES8533-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MIB1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

MIB1 Polyclonal Antibody
ABP57540-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic peptide from human protein at AA range: 901-950
  • Applications tips:
Description: A polyclonal antibody for detection of MIB1 from Human, Mouse, Rat. This MIB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 901-950

MIB1 Polyclonal Antibody
ABP57540-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 901-950
  • Applications tips:
Description: A polyclonal antibody for detection of MIB1 from Human, Mouse, Rat. This MIB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 901-950

MIB1 Polyclonal Antibody
ABP57540-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 901-950
  • Applications tips:
Description: A polyclonal antibody for detection of MIB1 from Human, Mouse, Rat. This MIB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 901-950

MIB1 Polyclonal Antibody
A54177 100 µg
EUR 570.55
Description: kits suitable for this type of research

MIB1 Polyclonal Antibody
46750-100ul 100ul
EUR 252

MIB1 Polyclonal Antibody
46750-50ul 50ul
EUR 187

MIB1 Rabbit pAb
A8588-100ul 100 ul
EUR 308

MIB1 Rabbit pAb
A8588-200ul 200 ul
EUR 459

MIB1 Rabbit pAb
A8588-20ul 20 ul
EUR 183

MIB1 Rabbit pAb
A8588-50ul 50 ul
EUR 223

MIB1 Polyclonal Conjugated Antibody
C46750 100ul
EUR 397

MIB1 Antibody
ABD8340 100 ug
EUR 438

Mib1 Antibody
49913-100ul 100ul
EUR 333

Mib1 Antibody
49913-50ul 50ul
EUR 239

MIB1 Antibody
45277-100ul 100ul
EUR 252

MIB1 Antibody
45277-50ul 50ul
EUR 187

MIB1 antibody
70R-15269 100 ug
EUR 327
Description: Rabbit polyclonal MIB1 antibody

MIB1 Antibody
DF8340 200ul
EUR 304
Description: MIB1 Antibody detects endogenous levels of total MIB1.

mib1 Antibody
1-CSB-PA896152LA01DIL
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against mib1. Recognizes mib1 from Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA

MIB1 Antibody
1-CSB-PA287419
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against MIB1. Recognizes MIB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000ELISA:1:10000

MIB1 Antibody
1-CSB-PA13289A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIB1. Recognizes MIB1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

MIB1 Polyclonal Antibody, HRP Conjugated
A54178 100 µg
EUR 570.55
Description: fast delivery possible

MIB1 Polyclonal Antibody, FITC Conjugated
A54179 100 µg
EUR 570.55
Description: reagents widely cited

MIB1 Polyclonal Antibody, Biotin Conjugated
A54180 100 µg
EUR 570.55
Description: Ask the seller for details

E3 Ubiquitin-Protein Ligase MIB1 (MIB1) Antibody
20-abx124134
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase MIB1 (mib1) Antibody
20-abx320032
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase MIB1 (MIB1) Antibody
20-abx216853
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase MIB1 (MIB1) Antibody
abx224331-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase MIB1 (MIB1) Antibody
abx224444-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Polyclonal Mib1/Mindbomb Antibody (N-term)
AMM08648G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mib1/Mindbomb (N-term). This antibody is tested and proven to work in the following applications:

MIB1 Conjugated Antibody
C45277 100ul
EUR 397

Mib1 Conjugated Antibody
C49913 100ul
EUR 397

Mib1 / Mindbomb Antibody
abx031563-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mib1 / Mindbomb Antibody
abx031563-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

MIB1 antibody (HRP)
60R-1645 100 ug
EUR 327
Description: Rabbit polyclonal MIB1 antibody (HRP)

MIB1 antibody (FITC)
60R-1646 100 ug
EUR 327
Description: Rabbit polyclonal MIB1 antibody (FITC)

MIB1 antibody (biotin)
60R-1647 100 ug
EUR 327
Description: Rabbit polyclonal MIB1 antibody (biotin)

Anti-MIB1 antibody
STJ98646 200 µl
EUR 197
Description: Rabbit polyclonal to MIB1.

Anti-MIB1 antibody
STJ111320 100 µl
EUR 277
Description: This gene encodes a protein containing multiple ankyrin repeats and RING finger domains that functions as an E3 ubiquitin ligase. The encoded protein positively regulates Notch signaling by ubiquitinating the Notch receptors, thereby facilitating their endocytosis. This protein may also promote the ubiquitination and degradation of death-associated protein kinase 1 (DAPK1).

E3 Ubiquitin-Protein Ligase MIB1 (MIB1) Antibody Pair
abx117552-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase MIB1 (mib1) Antibody (HRP)
20-abx320033
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase MIB1 (mib1) Antibody (FITC)
20-abx320034
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase MIB1 (mib1) Antibody (Biotin)
20-abx320035
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

E3 ubiquitin-protein ligase MIB1 Polyclonal Antibody
42567-100ul 100ul
EUR 333

Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human)
4-PAL727Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MIB1 (Arg769~Glu1000)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1)

MIB1 siRNA
20-abx924120
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MIB1 siRNA
20-abx924121
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-Mib1/Mindbomb Antibody
A01387-1 100ug/vial
EUR 294

mib1 Antibody, HRP conjugated
1-CSB-PA896152LB01DIL
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against mib1. Recognizes mib1 from Zebrafish. This antibody is HRP conjugated. Tested in the following application: ELISA

mib1 Antibody, FITC conjugated
1-CSB-PA896152LC01DIL
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against mib1. Recognizes mib1 from Zebrafish. This antibody is FITC conjugated. Tested in the following application: ELISA

mib1 Antibody, Biotin conjugated
1-CSB-PA896152LD01DIL
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against mib1. Recognizes mib1 from Zebrafish. This antibody is Biotin conjugated. Tested in the following application: ELISA

MIB1 Antibody, HRP conjugated
1-CSB-PA13289B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIB1. Recognizes MIB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MIB1 Antibody, FITC conjugated
1-CSB-PA13289C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIB1. Recognizes MIB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MIB1 Antibody, Biotin conjugated
1-CSB-PA13289D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIB1. Recognizes MIB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human E3 ubiquitin-protein ligase MIB1 (MIB1)
1-CSB-RP132874h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human E3 ubiquitin-protein ligase MIB1(MIB1) ,partial expressed in E.coli

E3 ubiquitin-protein ligase MIB1 Polyclonal Conjugated Antibody
C42567 100ul
EUR 397

Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), APC
4-PAL727Hu01-APC
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MIB1 (Arg769~Glu1000)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with APC.

Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), Biotinylated
4-PAL727Hu01-Biotin
  • EUR 327.00
  • EUR 2684.00
  • EUR 783.00
  • EUR 403.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MIB1 (Arg769~Glu1000)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with Biotin.

Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), Cy3
4-PAL727Hu01-Cy3
  • EUR 447.00
  • EUR 4733.00
  • EUR 1277.00
  • EUR 585.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MIB1 (Arg769~Glu1000)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with Cy3.

Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), FITC
4-PAL727Hu01-FITC
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MIB1 (Arg769~Glu1000)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with FITC.

Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), HRP
4-PAL727Hu01-HRP
  • EUR 334.00
  • EUR 3120.00
  • EUR 873.00
  • EUR 424.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MIB1 (Arg769~Glu1000)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with HRP.

Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), PE
4-PAL727Hu01-PE
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MIB1 (Arg769~Glu1000)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with PE.

MIB1 Blocking Peptide
DF8340-BP 1mg
EUR 195

MIB1 cloning plasmid
CSB-CL771476HU-10ug 10ug
EUR 1085
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3021
  • Sequence: ATGAGTAACTCCCGGAATAACCGGGTGATGGTGGAAGGGGTTGGCGCTCGGGTAGTGCGCGGCCCGGACTGGAAGTGGGGGAAGCAGGACGGCGGCGAGGGCCATGTGGGCACCGTCCGGAGCTTCGAGAGCCCCGAGGAGGTGGTGGTAGTGTGGGACAACGGCACAGCTGCCA
  • Show more
Description: A cloning plasmid for the MIB1 gene.

anti-Mib1/Mindbomb
YF-PA26487 50 ul
EUR 334
Description: Mouse polyclonal to Mib1/Mindbomb

Mindbomb Homolog 1 (MIB1) Antibody
20-abx101780
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mindbomb Homolog 1 (MIB1) Polyclonal Antibody (Human), APC-Cy7
4-PAL727Hu01-APC-Cy7
  • EUR 614.00
  • EUR 7042.00
  • EUR 1858.00
  • EUR 821.00
  • EUR 337.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MIB1 (Arg769~Glu1000)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Mindbomb Homolog 1 (MIB1). This antibody is labeled with APC-Cy7.

Mouse E3 ubiquitin- protein ligase MIB1, Mib1 ELISA KIT
ELI-37178m 96 Tests
EUR 865

Human E3 ubiquitin- protein ligase MIB1, MIB1 ELISA KIT
ELI-43761h 96 Tests
EUR 824

Human E3 ubiquitin-protein ligase MIB1 (MIB1) ELISA Kit
abx385152-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse E3 ubiquitin-protein ligase MIB1 (MIB1) ELISA Kit
abx389880-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

E3 ubiquitin-protein ligase MIB1 Antibody
20-abx109743
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse MIB1 shRNA Plasmid
20-abx981387
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MIB1 ELISA KIT|Human
EF005271 96 Tests
EUR 689

Human MIB1 shRNA Plasmid
20-abx961514
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-Mib1/Mindbomb (3E10)
YF-MA19072 100 ug
EUR 363
Description: Mouse monoclonal to Mib1/Mindbomb

Anti-Mib1/Mindbomb (2A9)
YF-MA19073 100 ug
EUR 363
Description: Mouse monoclonal to Mib1/Mindbomb

Mib1 ELISA Kit| Mouse E3 ubiquitin-protein ligase MIB1 ELISA Ki
EF015517 96 Tests
EUR 689

MIB1 Rabbit Polyclonal Antibody