MIA2 Rabbit Polyclonal Antibody

MIA2 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

MIA2 Polyclonal Antibody

ABP53665-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human MIA2 at AA rangle: 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of MIA2 from Human. This MIA2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MIA2 at AA rangle: 100-180

MIA2 Polyclonal Antibody

ABP53665-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human MIA2 at AA rangle: 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of MIA2 from Human. This MIA2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MIA2 at AA rangle: 100-180

MIA2 Polyclonal Antibody

ABP53665-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human MIA2 at AA rangle: 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of MIA2 from Human. This MIA2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MIA2 at AA rangle: 100-180

MIA2 Polyclonal Antibody

ABP57504-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from MIA2 at AA range: 361-410
  • Applications tips:
Description: A polyclonal antibody for detection of MIA2 from Human. This MIA2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from MIA2 at AA range: 361-410

MIA2 Polyclonal Antibody

ABP57504-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from MIA2 at AA range: 361-410
  • Applications tips:
Description: A polyclonal antibody for detection of MIA2 from Human. This MIA2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from MIA2 at AA range: 361-410

MIA2 Polyclonal Antibody

ABP57504-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from MIA2 at AA range: 361-410
  • Applications tips:
Description: A polyclonal antibody for detection of MIA2 from Human. This MIA2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from MIA2 at AA range: 361-410

MIA2 Polyclonal Antibody

ES8497-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MIA2 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

MIA2 Polyclonal Antibody

ES8497-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MIA2 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

MIA2 Polyclonal Antibody

ES4664-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MIA2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MIA2 Polyclonal Antibody

ES4664-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MIA2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MIA2 antibody

70R-10165 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MIA2 antibody

MIA2 Antibody

34780-100ul 100ul
EUR 252

MIA2 Antibody

34780-50ul 50ul
EUR 187

MIA2 Antibody

CSB-PA056159-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MIA2. Recognizes MIA2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

MIA2 Antibody

CSB-PA056159-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MIA2. Recognizes MIA2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

MIA2 Antibody

1-CSB-PA822278LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIA2. Recognizes MIA2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

MIA2 Antibody

DF4156 200ul
EUR 304
Description: MIA2 Antibody detects endogenous levels of total MIA2.

MIA2 Antibody

1-CSB-PA512374
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MIA2. Recognizes MIA2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

MIA2 Antibody

1-CSB-PA006882
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MIA2. Recognizes MIA2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

MIA2 antibody

70R-MR033 50 ug
EUR 273
Description: Affinity purified Rabbit polyclonal MIA2 antibody

MIA2 antibody

70R-35803 100 ug
EUR 327
Description: Rabbit polyclonal MIA2 antibody

MIA2 Antibody

ABD4156 100 ug
EUR 438

Anti-MIA2 Antibody

A08319 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for MIA2 Antibody (MIA2) detection.tested for IHC, WB in Human.

MIA2 Conjugated Antibody

C34780 100ul
EUR 397

Anti-MIA2 antibody

STJ94121 200 µl
EUR 197
Description: Rabbit polyclonal to MIA2.

Anti-MIA2 antibody

STJ98610 200 µl
EUR 197
Description: Rabbit polyclonal to MIA2.

MIA2 protein

30R-2749 20 ug
EUR 302
Description: Purified recombinant Human MIA2 protein

MIA2 protein

30R-AM044 20 ug
EUR 273
Description: Purified recombinant Human MIA2 protein

MIA2 siRNA

20-abx924114
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MIA2 siRNA

20-abx924115
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MIA2 Antibody, HRP conjugated

1-CSB-PA822278LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIA2. Recognizes MIA2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MIA2 Antibody, FITC conjugated

1-CSB-PA822278LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIA2. Recognizes MIA2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MIA2 Antibody, Biotin conjugated

1-CSB-PA822278LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIA2. Recognizes MIA2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MIA2 Blocking Peptide

33R-6899 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MIA2 antibody, catalog no. 70R-10165

MIA2 Blocking Peptide

DF4156-BP 1mg
EUR 195

MIA2 cloning plasmid

CSB-CL822278HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1965
  • Sequence: atggcaaaatttggcgttcacagaatccttcttctggctatttctctgacaaagtgtctggagagtacaaaactgctggcagaccttaaaaaatgtggtgacttggaatgtgaagctttaataaacagagtctcagccatgagagattatagaggacctgactgccgatacctga
  • Show more
Description: A cloning plasmid for the MIA2 gene.

Anti-MIA2 (2B9)

YF-MA20607 100 ug
EUR 363
Description: Mouse monoclonal to MIA2

Human MIA2 shRNA Plasmid

20-abx964549
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MIA2 shRNA Plasmid

20-abx983679
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Melanoma Inhibitory Activity Protein 2 (MIA2) Antibody

20-abx014574
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Melanoma Inhibitory Activity Protein 2 (MIA2) Antibody

abx331045-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Melanoma Inhibitory Activity Protein 2 (MIA2) Antibody

20-abx323747
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Melanoma Inhibitory Activity Protein 2 (MIA2) Antibody

20-abx324998
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

MIA2 Rabbit Polyclonal Antibody