MER/TYRO3 (Phospho-Tyr753/Tyr685) Rabbit Polyclonal Antibody

MER/TYRO3 (Phospho-Tyr753/Tyr685) Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

MER/TYRO3 (Phospho-Tyr753/Tyr685) Polyclonal Antibody
ABP57465-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthetic peptide from human protein at AA range: 650-770 Applications tips:
Description: A polyclonal antibody for detection of MER/TYRO3 Phospho-Tyr753/Tyr685) from Human, Mouse, Rat. This MER/TYRO3 Phospho-Tyr753/Tyr685) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 650-770

MER/TYRO3 (Phospho-Tyr753/Tyr685) Polyclonal Antibody
ABP57465-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthetic peptide from human protein at AA range: 650-770 Applications tips:
Description: A polyclonal antibody for detection of MER/TYRO3 Phospho-Tyr753/Tyr685) from Human, Mouse, Rat. This MER/TYRO3 Phospho-Tyr753/Tyr685) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 650-770

MER/TYRO3 (Phospho-Tyr753/Tyr685) Polyclonal Antibody
ABP57465-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic peptide from human protein at AA range: 650-770 Applications tips:
Description: A polyclonal antibody for detection of MER/TYRO3 Phospho-Tyr753/Tyr685) from Human, Mouse, Rat. This MER/TYRO3 Phospho-Tyr753/Tyr685) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 650-770

Anti-MER/TYRO3 (Phospho-Tyr753/Tyr685) antibody
STJ98571	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to MER/TYRO3 (Phospho-Tyr753/Tyr685).

Phospho-MER/TYRO3 (Tyr753/Tyr685) Blocking Peptide
AF8443-BP	Affbiotech	1mg	EUR 195

MER / TYRO3 Antibody
20-abx013011	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

MER/TYRO3 Antibody
DF10363	Affbiotech	200ul	EUR 304
Description: MER/TYRO3 Antibody detects endogenous levels of MER/TYRO3.

MER / TYRO3 (pY753 / Y685) Antibody
abx216802-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

MER/TYRO3 Blocking Peptide
DF10363-BP	Affbiotech	1mg	EUR 195

Rabbit Anti-Human PLCG2 Polyclonal Antibody, Phospho-Tyr753
CPB-725RH	Creative Diagnostics	100 ul	EUR 559

MER/TYRO3 (Ab-753/685) Antibody
33314-100ul	SAB	100ul	EUR 252

MER/TYRO3 (Ab-753/685) Antibody
33314-50ul	SAB	50ul	EUR 187

PLCγ2 (Phospho-Tyr753) Polyclonal Conjugated Antibody
C11175	SAB	100ul	EUR 397

PLC ?2 (phospho Tyr753) Polyclonal Antibody
ES1477-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PLC ?2 (phospho Tyr753) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PLC ?2 (phospho Tyr753) Polyclonal Antibody
ES1477-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PLC ?2 (phospho Tyr753) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PLC Gamma2 (phospho Tyr753) Polyclonal Antibody
ABP50478-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human PLC ?2 around the phosphorylation site of Y753 Applications tips:
Description: A polyclonal antibody for detection of PLC ?2 phospho Tyr753) from Human, Mouse, Rat. This PLC ?2 phospho Tyr753) antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human PLC ?2 around the phosphorylation site of Y753

PLC Gamma2 (phospho Tyr753) Polyclonal Antibody
ABP50478-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human PLC ?2 around the phosphorylation site of Y753 Applications tips:
Description: A polyclonal antibody for detection of PLC ?2 phospho Tyr753) from Human, Mouse, Rat. This PLC ?2 phospho Tyr753) antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human PLC ?2 around the phosphorylation site of Y753

PLC Gamma2 (phospho Tyr753) Polyclonal Antibody
ABP50478-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human PLC ?2 around the phosphorylation site of Y753 Applications tips:
Description: A polyclonal antibody for detection of PLC ?2 phospho Tyr753) from Human, Mouse, Rat. This PLC ?2 phospho Tyr753) antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human PLC ?2 around the phosphorylation site of Y753

Phospho-PLCG2 (Tyr753) Antibody
AF3192	Affbiotech	200ul	EUR 304
Description: Phospho-PLCG2 (Tyr753) Antibody detects endogenous levels of PLCG2 only when phosphorylated at Tyrosine 753.

Phospho- PLCG2 (Tyr753) Antibody
ABF3192	Lifescience Market	100 ug	EUR 438

PLCγ2 (Phospho-Tyr753) Antibody
11175-100ul	SAB	100ul	EUR 252

PLCγ2 (Phospho-Tyr753) Antibody
11175-50ul	SAB	50ul	EUR 187

Phospho-PLCG2 (Tyr753) Antibody
CSB-PA782484-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-PLCG2 (Tyr753). Recognizes Phospho-PLCG2 (Tyr753) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200

Phospho-PLCG2 (Tyr753) Antibody
CSB-PA782484-100ul	Cusabio	100ul	EUR 362
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-PLCG2 (Tyr753). Recognizes Phospho-PLCG2 (Tyr753) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200

MERTK (phospho-Tyr753/685) Antibody
13320-100ul	SAB	100ul	EUR 252

MERTK (phospho-Tyr753/685) Conjugated Antibody
C13320	SAB	100ul	EUR 397

Phospho-PLCG2 (Tyr753) Blocking Peptide
AF3192-BP	Affbiotech	1mg	EUR 195

anti-PLCγ2 (Phospho-Tyr753)
LF-PA20416	Abfrontier	100 ul	EUR 354
Description: Rabbit polyclonal to PLCγ2 (Phospho-Tyr753)

MerTK/Tyro3 (phospho Tyr749/681) Polyclonal Antibody
ES4477-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MerTK/Tyro3 (phospho Tyr749/681) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

MerTK/Tyro3 (phospho Tyr749/681) Polyclonal Antibody
ES4477-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MerTK/Tyro3 (phospho Tyr749/681) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

MerTK/Tyro3 (phospho Tyr749/681) Polyclonal Antibody
ABP53478-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human MerTK/Tyro3 around the phosphorylation site of Y749/681 Applications tips:
Description: A polyclonal antibody for detection of MerTK/Tyro3 phospho Tyr749/681) from Human, Mouse, Rat. This MerTK/Tyro3 phospho Tyr749/681) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MerTK/Tyro3 around the phosphorylation site of Y749/681

MerTK/Tyro3 (phospho Tyr749/681) Polyclonal Antibody
ABP53478-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human MerTK/Tyro3 around the phosphorylation site of Y749/681 Applications tips:
Description: A polyclonal antibody for detection of MerTK/Tyro3 phospho Tyr749/681) from Human, Mouse, Rat. This MerTK/Tyro3 phospho Tyr749/681) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MerTK/Tyro3 around the phosphorylation site of Y749/681

MerTK/Tyro3 (phospho Tyr749/681) Polyclonal Antibody
ABP53478-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human MerTK/Tyro3 around the phosphorylation site of Y749/681 Applications tips:
Description: A polyclonal antibody for detection of MerTK/Tyro3 phospho Tyr749/681) from Human, Mouse, Rat. This MerTK/Tyro3 phospho Tyr749/681) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MerTK/Tyro3 around the phosphorylation site of Y749/681

MerTK/Tyro3 (Phospho-Tyr749/681) Polyclonal Antibody
12338-100ul	SAB	100ul	EUR 252

MerTK/Tyro3 (Phospho-Tyr749/681) Polyclonal Antibody
12338-50ul	SAB	50ul	EUR 187

MER/SKY (Phospho-Tyr749/681) Polyclonal Conjugated Antibody
C11740	SAB	100ul	EUR 397

Polyclonal TYRO3 Antibody
APR13892G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TYRO3 . This antibody is tested and proven to work in the following applications:

MerTK/Tyro3 (Phospho-Tyr749/681) Polyclonal Polyclonal Conjugated Antibody
C12338	SAB	100ul	EUR 397

MER / SKY (Phospho-Tyr749 / 681) Antibody
20-abx012609	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00 EUR 70.00	100 ug 10 ug 200 ug 300 µg 5 ug
Shipped within 5-10 working days.

MER/SKY (Phospho-Tyr749/681) Antibody
11740-100ul	SAB	100ul	EUR 252

MER/SKY (Phospho-Tyr749/681) Antibody
11740-50ul	SAB	50ul	EUR 187

PLCG2 antibody (Tyr753)
70R-37250	Fitzgerald	100 ug	EUR 349
Description: Rabbit Polyclonal PLCG2 antibody (Tyr753)

PLCG2 antibody (Tyr753)
70R-31043	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal PLCG2 antibody (Tyr753)

TYRO3 Rabbit pAb
A12241-100ul	Abclonal	100 ul	EUR 308

TYRO3 Rabbit pAb
A12241-200ul	Abclonal	200 ul	EUR 459

TYRO3 Rabbit pAb
A12241-20ul	Abclonal	20 ul	EUR 183

TYRO3 Rabbit pAb
A12241-50ul	Abclonal	50 ul	EUR 223

TYRO3 Rabbit pAb
A14259-100ul	Abclonal	100 ul	EUR 308

TYRO3 Rabbit pAb
A14259-200ul	Abclonal	200 ul	EUR 459

TYRO3 Rabbit pAb
A14259-20ul	Abclonal	20 ul	EUR 183

TYRO3 Rabbit pAb
A14259-50ul	Abclonal	50 ul	EUR 223

MER antibody
10R-1849	Fitzgerald	100 ul	EUR 349
Description: Mouse monoclonal MER antibody

MerTK/Tyro3 Polyclonal Antibody
ES2780-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MerTK/Tyro3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MerTK/Tyro3 Polyclonal Antibody
ES2780-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MerTK/Tyro3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MerTK/Tyro3 Polyclonal Antibody
ES4478-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MerTK/Tyro3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

MerTK/Tyro3 Polyclonal Antibody
ES4478-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MerTK/Tyro3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

MerTK/Tyro3 Polyclonal Antibody
ABP53479-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y749/681 Applications tips:
Description: A polyclonal antibody for detection of MerTK/Tyro3 from Human, Mouse, Rat. This MerTK/Tyro3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y749/681

MerTK/Tyro3 Polyclonal Antibody
ABP53479-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y749/681 Applications tips:
Description: A polyclonal antibody for detection of MerTK/Tyro3 from Human, Mouse, Rat. This MerTK/Tyro3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y749/681

MerTK/Tyro3 Polyclonal Antibody
ABP53479-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y749/681 Applications tips:
Description: A polyclonal antibody for detection of MerTK/Tyro3 from Human, Mouse, Rat. This MerTK/Tyro3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y749/681

MerTK/Tyro3 Polyclonal Antibody
ABP51781-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y753/Y685 Applications tips:
Description: A polyclonal antibody for detection of MerTK/Tyro3 from Human, Mouse, Rat. This MerTK/Tyro3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y753/Y685

MerTK/Tyro3 Polyclonal Antibody
ABP51781-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y753/Y685 Applications tips:
Description: A polyclonal antibody for detection of MerTK/Tyro3 from Human, Mouse, Rat. This MerTK/Tyro3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y753/Y685

MerTK/Tyro3 Polyclonal Antibody
ABP51781-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y753/Y685 Applications tips:
Description: A polyclonal antibody for detection of MerTK/Tyro3 from Human, Mouse, Rat. This MerTK/Tyro3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y753/Y685

TYRO3/MERTK (phospho-Tyr749/681) Antibody
13303-100ul	SAB	100ul	EUR 252

Phospho-MERTK/TYRO3 (Y749/681) Antibody
1-CSB-PA006532	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-MERTK/TYRO3 (Y749/681). Recognizes Phospho-MERTK/TYRO3 (Y749/681) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Phospho-MERTK/TYRO3 (Tyr749/681) Antibody
CSB-PA038071-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie Show more
Description: A polyclonal antibody against Phospho-MERTK/TYRO3 (Tyr749/681). Recognizes Phospho-MERTK/TYRO3 (Tyr749/681) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Phospho-MERTK/TYRO3 (Tyr749/681) Antibody
CSB-PA038071-100ul	Cusabio	100ul	EUR 362
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie Show more
Description: A polyclonal antibody against Phospho-MERTK/TYRO3 (Tyr749/681). Recognizes Phospho-MERTK/TYRO3 (Tyr749/681) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Anti-MERTK/Mer Rabbit Monoclonal Antibody
M00489	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal MERTK/Mer Antibody. Validated in IP, IHC, WB and tested in Human.

Phospholipase C Gamma 2 Phospho-Tyr753 (PLCG2 pY753) Antibody
20-abx329059	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Phospholipase C Gamma 2 Phospho-Tyr753 (PLCG2 pY753) Antibody
abx333144-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

Polyclonal TYRO3 Antibody (C-term)
APR13894G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TYRO3 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TYRO3 Antibody (C-term)
APR13895G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TYRO3 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal MER / MERTK Antibody (C-Terminus)
AMM06377G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MER / MERTK (C-Terminus). This antibody is tested and proven to work in the following applications:

Tyro3 Antibody
BF0294	Affbiotech	200ul	EUR 376
Description: Tyro3 antibody detects endogenous levels of total Tyro3.

TYRO3 Antibody
ABD13301	Lifescience Market	100 ug	EUR 438

TYRO3 Antibody
ABD2680	Lifescience Market	100 ug	EUR 438

TYRO3 Antibody
44890-100ul	SAB	100ul	EUR 252

TYRO3 Antibody
44890-50ul	SAB	50ul	EUR 187

TYRO3 antibody
10R-6193	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TYRO3 antibody

TYRO3 antibody
10R-6194	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TYRO3 antibody

TYRO3 antibody
10R-6195	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TYRO3 antibody

TYRO3 antibody
10R-6196	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TYRO3 antibody

TYRO3 antibody
10R-6197	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TYRO3 antibody

TYRO3 antibody
10R-6198	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal TYRO3 antibody

TYRO3 antibody
10R-6199	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal TYRO3 antibody

TYRO3 antibody
10R-2052	Fitzgerald	100 ul	EUR 403
Description: Mouse monoclonal TYRO3 antibody

TYRO3 antibody
10R-2105	Fitzgerald	100 ul	EUR 403
Description: Mouse monoclonal TYRO3 antibody

TYRO3 antibody
10R-2165	Fitzgerald	100 ul	EUR 403
Description: Mouse monoclonal TYRO3 antibody

TYRO3 Antibody
DF2680	Affbiotech	200ul	EUR 304
Description: TYRO3 antibody detects endogenous levels of total TYRO3.

TYRO3 Antibody
1-CSB-PA025396LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TYRO3. Recognizes TYRO3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

TYRO3/MERTK (phospho-Tyr749/681) Conjugated Antibody
C13303	SAB	100ul	EUR 397

Anti-Phospho-MerTK/Tyro3 (Y749/681) antibody
STJ90948	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Phospho-MerTK/Tyro3 (Y749/681).

Meropenem (MER) Antibody
abx016037-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

PLCG2 (Phospho-Tyr753) Colorimetric Cell-Based ELISA Kit
EKC1995	BosterBio	100ul	EUR 572

Rabbit Tyrosine protein kinase receptor TYRO3(TYRO3) ELISA kit
E04T0746-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tyrosine protein kinase receptor TYRO3(TYRO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tyrosine protein kinase receptor TYRO3(TYRO3) ELISA kit
E04T0746-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tyrosine protein kinase receptor TYRO3(TYRO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tyrosine protein kinase receptor TYRO3(TYRO3) ELISA kit
E04T0746-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tyrosine protein kinase receptor TYRO3(TYRO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Phospho-PLCG2 (Tyr753) Colorimetric Cell-Based ELISA Kit (OKAG01520)
OKAG01520	Aviva Systems Biology	2 x 96 Wells	EUR 740
Description: Description of target: ;Species reactivity: Human: Y753, Mouse: Y753, Rat: Y753;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: Phospho Detection Method: Colorimetric 450 nm;Sensitivity:

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody
20-abx126751	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody
20-abx147463	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody
abx033610-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody
abx033610-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody
abx033611-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody
abx033611-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (Tyro3) Antibody
abx012308-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody
abx015715-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (Tyro3) Antibody
abx016061-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody
20-abx302282	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TYRO3 Conjugated Antibody
C44890	SAB	100ul	EUR 397

MERTK / TYRO3 Antibody
20-abx327090	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

MERTK / TYRO3 Antibody
20-abx328512	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Anti-TYRO3 Antibody
A00913-1	BosterBio	100ug/vial	EUR 334

MERTK/TYRO3 Antibody
1-CSB-PA003230	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MERTK/TYRO3. Recognizes MERTK/TYRO3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

MERTK/TYRO3 Antibody
1-CSB-PA006534	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MERTK/TYRO3. Recognizes MERTK/TYRO3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

Anti-TYRO3 Antibody
STJ503444	St John's Laboratory	100 µg	EUR 515

Anti-Tyro3 antibody
STJ98440	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to Tyro3.

Anti-Tyro3 antibody
STJ98441	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to Tyro3.

Anti-Tyro3 antibody
STJ98442	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to Tyro3.

Anti-Tyro3 antibody
STJ98443	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to Tyro3.

Anti-TYRO3 antibody
STJ114132	St John's Laboratory	100 µl	EUR 277
Description: The gene is part of a 3-member transmembrane receptor kinase receptor family with a processed pseudogene distal on chromosome 15. The encoded protein is activated by the products of the growth arrest-specific gene 6 and protein S genes and is involved in controlling cell survival and proliferation, spermatogenesis, immunoregulation and phagocytosis. The encoded protein has also been identified as a cell entry factor for Ebola and Marburg viruses.

Anti-TYRO3 antibody
STJ116472	St John's Laboratory	100 µl	EUR 277
Description: The gene is part of a 3-member transmembrane receptor kinase receptor family with a processed pseudogene distal on chromosome 15. The encoded protein is activated by the products of the growth arrest-specific gene 6 and protein S genes and is involved in controlling cell survival and proliferation, spermatogenesis, immunoregulation and phagocytosis. The encoded protein has also been identified as a cell entry factor for Ebola and Marburg viruses.

Tyro3/ Rat Tyro3 ELISA Kit
ELI-51317r	Lifescience Market	96 Tests	EUR 886

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody (HRP)
20-abx316068	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody (FITC)
20-abx316069	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody (Biotin)
20-abx316070	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

anti-MER (7E5G1)
LF-MA30130	Abfrontier	100 ul	EUR 445
Description: Mouse Monoclonal to MER

TYRO3 siRNA
20-abx905891	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TYRO3 siRNA
20-abx938683	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TYRO3 siRNA
20-abx938684	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-TYRO3
YF-PA15186	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to TYRO3

anti-TYRO3
YF-PA24922	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to TYRO3

Monoclonal MER Antibody, Clone: 7E5G1
AMM02647G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human MER. The antibodies are raised in Mouse and are from clone 7E5G1. This antibody is applicable in WB, E

MER (Ab-753) Conjugated Antibody
C33314	SAB	100ul	EUR 397

PRC1(Phospho-Thr481)Rabbit Polyclonal Antibody
ES8619-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PRC1(Phospho-Thr481)Rabbit from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PRC1(Phospho-Thr481)Rabbit Polyclonal Antibody
ES8619-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PRC1(Phospho-Thr481)Rabbit from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ATM Phospho (Ser1981) Rabbit Polyclonal Antibody
Ab11236-050	GenDepot	50ul	EUR 347

ATM Phospho (Ser1981) Rabbit Polyclonal Antibody
Ab11236-100	GenDepot	100ul	EUR 482

TYRO3 Antibody, HRP conjugated
1-CSB-PA025396LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TYRO3. Recognizes TYRO3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TYRO3 Antibody, FITC conjugated
1-CSB-PA025396LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TYRO3. Recognizes TYRO3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TYRO3 Antibody, Biotin conjugated
1-CSB-PA025396LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TYRO3. Recognizes TYRO3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-MerTK/Tyro3 antibody
STJ94099	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to MerTK/Tyro3.

Anti-MerTK/Tyro3 antibody
STJ94100	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to MerTK/Tyro3.

Anti-TYRO3 Antibody (Biotin)
STJ503445	St John's Laboratory	100 µg	EUR 586

Anti-TYRO3 Antibody (FITC)
STJ503446	St John's Laboratory	100 µg	EUR 586

Human Mer/MERTK(Tyrosine-protein kinase Mer) ELISA Kit
EH0224	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: Q12866 Alias: Mer/MERTK
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Rabbit Anti-Rabbit SYN1 Polyclonal Antibody, Phospho-Ser9
CPB-795RH	Creative Diagnostics	100 ul	EUR 559

Rabbit Anti-Rabbit Th Polyclonal Antibody, Phospho-Ser19
CPB-840RR	Creative Diagnostics	100 ul	EUR 559

Rabbit Anti-Rabbit PIK3R1 Polyclonal Antibody, Phospho-Tyr467
CPB-847RH	Creative Diagnostics	100 ul	EUR 559

Rabbit Anti-Rabbit ERBB3 Polyclonal Antibody, Phospho-Tyr1328
CPB-848RH	Creative Diagnostics	100 ul	EUR 559

Rabbit Anti-Rabbit EIF4G1 Polyclonal Antibody, Phospho-Ser1232
CPB-851RH	Creative Diagnostics	100 ul	EUR 559

Rabbit Anti-Rabbit PRKCQ Polyclonal Antibody, Phospho-Ser695
CPB-723RH	Creative Diagnostics	100 ul	EUR 559

Rabbit Anti-Rabbit CTNNB1 Polyclonal Antibody, Phospho-Ser33
CPB-758RH	Creative Diagnostics	100 ul	EUR 559

Rabbit Anti-Rabbit CTNNB1 Polyclonal Antibody, Phospho-Ser37
CPB-759RH	Creative Diagnostics	100 ul	EUR 559

Meropenem (Mer) Protein (BSA)
20-abx651891	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Meropenem (Mer) Protein (OVA)
20-abx651892	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

TIP 39 (39 mer)
5-02006	CHI Scientific	4 x 1mg	Ask for price

Human Mer ELISA Kit
55R-1758	Fitzgerald	1 kit	EUR 671
Description: ELISA kit for detection of Mer in the research laboratory

BSA Conjugated Meropenem (Mer)
4-CPK946Ge11	Cloud-Clone	EUR 440.48 EUR 221.00 EUR 1376.80 EUR 525.60 EUR 951.20 EUR 358.00 EUR 3292.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4. Form: Freeze-dried powder Predicted Molecular Mass (KD): 383.5Da Isoelectric Point: Inquire
Description: Recombinant Pan-species Meropenem expressed in: E.coli

OVA Conjugated Meropenem (Mer)
4-CPK946Ge21	Cloud-Clone	EUR 440.48 EUR 221.00 EUR 1376.80 EUR 525.60 EUR 951.20 EUR 358.00 EUR 3292.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4. Form: Freeze-dried powder Predicted Molecular Mass (KD): 383.5Da Isoelectric Point: Inquire
Description: Recombinant Pan-species Meropenem expressed in: E.coli

Human Mer ELISA kit
LF-EK50727	Abfrontier	1×96T	EUR 659

Tyrosine-Protein Kinase Mer (MERTK) Antibody
20-abx125366	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody
abx033726-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody
abx033726-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody
20-abx008332	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody
20-abx008333	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody
20-abx004167	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody
20-abx015165	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody
20-abx322134	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody
20-abx322182	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody
abx432965-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody
abx432966-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Histone H3(Phospho-Thr3) Rabbit Polyclonal Antibody
12083-100ul	SAB	100ul	EUR 252

Histone H3(Phospho-Ser10) Rabbit Polyclonal Antibody
12084-100ul	SAB	100ul	EUR 252

Histone H3(Phospho-Thr11) Rabbit Polyclonal Antibody
12085-100ul	SAB	100ul	EUR 252

Histone H3(Phospho-Ser28) Rabbit Polyclonal Antibody
12086-100ul	SAB	100ul	EUR 252

Histone H3(Phospho-Thr32) Rabbit Polyclonal Antibody
12087-100ul	SAB	100ul	EUR 252

Histone H3(Phospho-Tyr41) Rabbit Polyclonal Antibody
12088-100ul	SAB	100ul	EUR 252

Histone H3(Phospho-Thr45) Rabbit Polyclonal Antibody
12089-100ul	SAB	100ul	EUR 252

Histone H3(Phospho-Thr118) Rabbit Polyclonal Antibody
12090-100ul	SAB	100ul	EUR 252

Histone H4(Phospho-Ser1) Rabbit Polyclonal Antibody
12091-100ul	SAB	100ul	EUR 252

Histone H4(Phospho-Ser47) Rabbit Polyclonal Antibody
12092-100ul	SAB	100ul	EUR 252

Histone H4(Phospho-Thr80) Rabbit Polyclonal Antibody
12093-100ul	SAB	100ul	EUR 252

Histone H2B(Phospho-Ser32) Rabbit Polyclonal Antibody
12094-100ul	SAB	100ul	EUR 252

Histone H2A(Phospho-Ser129) Rabbit Polyclonal Antibody
12095-100ul	SAB	100ul	EUR 252

Histone H1(Phospho-Ser1) Rabbit Polyclonal Antibody
12096-100ul	SAB	100ul	EUR 252

Histone H1(Phospho-Thr3) Rabbit Polyclonal Antibody
12097-100ul	SAB	100ul	EUR 252

Histone H2A.X(Phospho-Thr120) Rabbit Polyclonal Antibody
12099-100ul	SAB	100ul	EUR 252

Histone H2A.X(Phospho-Ser139) Rabbit Polyclonal Antibody
12100-100ul	SAB	100ul	EUR 252

Histone H2A.X(Phospho-Tyr142) Rabbit Polyclonal Antibody
12101-100ul	SAB	100ul	EUR 252

Histone H2B(Phospho-Ser14) Rabbit Polyclonal Antibody
12102-100ul	SAB	100ul	EUR 252

C-Mer Proto Oncogene Tyrosine Kinase (MERTK) Polyclonal Antibody (Human)
4-PAE271Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MERTK (Leu587~Leu858) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Mer Proto Oncogene Tyrosine Kinase (MERTK)

Monoclonal Tyro3 Antibody, Clone: 6D6F10
APR10622G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human Tyro3. The antibodies are raised in Mouse and are from clone 6D6F10. This antibody is applicable in ICC, E

Monoclonal TYRO3 Antibody, Clone: 10E11
APR11235G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human TYRO3. The antibodies are raised in Mouse and are from clone 10E11. This antibody is applicable in WB, E

Monoclonal TYRO3 Antibody, Clone: 1C10E8
AMM08413G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human TYRO3. The antibodies are raised in Mouse and are from clone 1C10E8. This antibody is applicable in WB, ICC, E

Monoclonal Tyro3 Antibody, Clone: 1444CT895.86.31
APR13893G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human Tyro3. The antibodies are raised in Mouse and are from clone 1444CT895.86.31. This antibody is applicable in WB, E

MERTK / TYRO3 (Ab-753) Antibody
abx332676-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

MERTK/TYRO3 (Ab-753) Antibody
CSB-PA114581-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against MERTK/TYRO3 (Ab-753). Recognizes MERTK/TYRO3 (Ab-753) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

MERTK/TYRO3 (Ab-753) Antibody
CSB-PA114581-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against MERTK/TYRO3 (Ab-753). Recognizes MERTK/TYRO3 (Ab-753) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Antibody for Human TYRO3 (pTyr681)
SPC-1092D	Stressmarq	0.1ml	EUR 354
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is unconjugated.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-A390	Stressmarq	0.1ml	EUR 401
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to ATTO 390.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-A488	Stressmarq	0.1ml	EUR 400
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to ATTO 488.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-A565	Stressmarq	0.1ml	EUR 400
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to ATTO 565.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-A594	Stressmarq	0.1ml	EUR 400
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to ATTO 594.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-A633	Stressmarq	0.1ml	EUR 400
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to ATTO 633.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-A655	Stressmarq	0.1ml	EUR 400
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to ATTO 655.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-A680	Stressmarq	0.1ml	EUR 400
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to ATTO 680.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-A700	Stressmarq	0.1ml	EUR 400
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to ATTO 700.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-ALP	Stressmarq	0.1ml	EUR 394
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to Alkaline Phosphatase.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-APC	Stressmarq	0.1ml	EUR 399
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to APC .

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-APCCY7	Stressmarq	0.1ml	EUR 471
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to APC/Cy7.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-BI	Stressmarq	0.1ml	EUR 396
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to Biotin.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-DY350	Stressmarq	0.1ml	EUR 475
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to Dylight 350.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-DY405	Stressmarq	0.1ml	EUR 452
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to Dylight 405.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-DY488	Stressmarq	0.1ml	EUR 432
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to Dylight 488.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-DY594	Stressmarq	0.1ml	EUR 436
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to Dylight 594.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-DY633	Stressmarq	0.1ml	EUR 426
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to Dylight 633.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-FITC	Stressmarq	0.1ml	EUR 392
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to FITC.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-HRP	Stressmarq	0.1ml	EUR 388
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to HRP.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-P594	Stressmarq	0.1ml	EUR 407
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to PE/ATTO 594.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-PCP	Stressmarq	0.1ml	EUR 399
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to PerCP.

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-RPE	Stressmarq	0.1ml	EUR 397
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to RPE .

Antibody for Human TYRO3 (pTyr681)
SPC-1092D-STR	Stressmarq	0.1ml	EUR 398
TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to Streptavidin.

Tyro3 Blocking Peptide
BF0294-BP	Affbiotech	1mg	EUR 195

TYRO3 cloning plasmid
CSB-CL025396HU1-10ug	Cusabio	10ug	EUR 859
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2673 Sequence: atggcgctgaggcggagcatggggcggccggggctcccgccgctgccgctgccgccgccactgcggctcgggctgctgctggcggctctggcttctctgctgctcccggagtccgccgccgcaggtctgaagctcatgggagccccggtgaagctgacagtgtctcaggggcagc Show more
Description: A cloning plasmid for the TYRO3 gene.

TYRO3 cloning plasmid
CSB-CL025396HU2-10ug	Cusabio	10ug	EUR 859
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2673 Sequence: atggcgctgaggcggagcatggggcggccggggctcccgccgctgccgctgccgccgccaccgcggctcgggctgctgctggcggctctggcttctctgctgctcccggagtccgccgccgcaggtctgaagctcatgggagccccggtgaagctgacagtgtctcaggggcagc Show more
Description: A cloning plasmid for the TYRO3 gene.

TYRO3 Blocking Peptide
DF2680-BP	Affbiotech	1mg	EUR 195

anti-TYRO3 (1C10E8)
LF-MA30113	Abfrontier	100 ul	EUR 486
Description: Mouse Monoclonal to TYRO3

anti-TYRO3 (10E11)
LF-MA30274	Abfrontier	100 ul	EUR 486
Description: Mouse Monoclonal to TYRO3

anti-Tyro3 (6D6F10)
LF-MA30359	Abfrontier	100 ul	EUR 486
Description: Mouse Monoclonal to Tyro3

Anti-TYRO3 (4F6)
YF-MA15996	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TYRO3

Histone H3(Phospho-Thr3) Rabbit Polyclonal Polyclonal Conjugated Antibody
C12083	SAB	100ul	EUR 397

Histone H3(Phospho-Ser10) Rabbit Polyclonal Polyclonal Conjugated Antibody
C12084	SAB	100ul	EUR 397

Histone H3(Phospho-Thr11) Rabbit Polyclonal Polyclonal Conjugated Antibody
C12085	SAB	100ul	EUR 397

Histone H3(Phospho-Ser28) Rabbit Polyclonal Polyclonal Conjugated Antibody
C12086	SAB	100ul	EUR 397

Histone H4(Phospho-Ser1) Rabbit Polyclonal Polyclonal Conjugated Antibody
C12091	SAB	100ul	EUR 397

Histone H2A.X(Phospho-Tyr142) Rabbit Polyclonal Polyclonal Conjugated Antibody
C12101	SAB	100ul	EUR 397

Histone H2B(Phospho-Ser14) Rabbit Polyclonal Polyclonal Conjugated Antibody
C12102	SAB	100ul	EUR 397

Mouse Tyrosine protein kinase receptor TYRO3(TYRO3) ELISA kit
E03T0746-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tyrosine protein kinase receptor TYRO3(TYRO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tyrosine protein kinase receptor TYRO3(TYRO3) ELISA kit
E03T0746-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tyrosine protein kinase receptor TYRO3(TYRO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

MER/TYRO3 (Phospho-Tyr753/Tyr685) Rabbit Polyclonal Antibody