MER/TYRO3 (Phospho-Tyr753/Tyr685) Rabbit Polyclonal Antibody

MER/TYRO3 (Phospho-Tyr753/Tyr685) Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

MER/TYRO3 (Phospho-Tyr753/Tyr685) Polyclonal Antibody

ABP57465-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic peptide from human protein at AA range: 650-770
  • Applications tips:
Description: A polyclonal antibody for detection of MER/TYRO3 Phospho-Tyr753/Tyr685) from Human, Mouse, Rat. This MER/TYRO3 Phospho-Tyr753/Tyr685) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 650-770

MER/TYRO3 (Phospho-Tyr753/Tyr685) Polyclonal Antibody

ABP57465-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 650-770
  • Applications tips:
Description: A polyclonal antibody for detection of MER/TYRO3 Phospho-Tyr753/Tyr685) from Human, Mouse, Rat. This MER/TYRO3 Phospho-Tyr753/Tyr685) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 650-770

MER/TYRO3 (Phospho-Tyr753/Tyr685) Polyclonal Antibody

ABP57465-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 650-770
  • Applications tips:
Description: A polyclonal antibody for detection of MER/TYRO3 Phospho-Tyr753/Tyr685) from Human, Mouse, Rat. This MER/TYRO3 Phospho-Tyr753/Tyr685) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 650-770

Anti-MER/TYRO3 (Phospho-Tyr753/Tyr685) antibody

STJ98571 200 µl
EUR 197
Description: Rabbit polyclonal to MER/TYRO3 (Phospho-Tyr753/Tyr685).

Phospho-MER/TYRO3 (Tyr753/Tyr685) Blocking Peptide

AF8443-BP 1mg
EUR 195

MER / TYRO3 Antibody

20-abx013011
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

MER/TYRO3 Antibody

DF10363 200ul
EUR 304
Description: MER/TYRO3 Antibody detects endogenous levels of MER/TYRO3.

MER / TYRO3 (pY753 / Y685) Antibody

abx216802-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

MER/TYRO3 Blocking Peptide

DF10363-BP 1mg
EUR 195

Rabbit Anti-Human PLCG2 Polyclonal Antibody, Phospho-Tyr753

CPB-725RH 100 ul
EUR 559

MER/TYRO3 (Ab-753/685) Antibody

33314-100ul 100ul
EUR 252

MER/TYRO3 (Ab-753/685) Antibody

33314-50ul 50ul
EUR 187

PLCγ2 (Phospho-Tyr753) Polyclonal Conjugated Antibody

C11175 100ul
EUR 397

PLC ?2 (phospho Tyr753) Polyclonal Antibody

ES1477-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PLC ?2 (phospho Tyr753) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PLC ?2 (phospho Tyr753) Polyclonal Antibody

ES1477-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PLC ?2 (phospho Tyr753) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PLC Gamma2 (phospho Tyr753) Polyclonal Antibody

ABP50478-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human PLC ?2 around the phosphorylation site of Y753
  • Applications tips:
Description: A polyclonal antibody for detection of PLC ?2 phospho Tyr753) from Human, Mouse, Rat. This PLC ?2 phospho Tyr753) antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human PLC ?2 around the phosphorylation site of Y753

PLC Gamma2 (phospho Tyr753) Polyclonal Antibody

ABP50478-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human PLC ?2 around the phosphorylation site of Y753
  • Applications tips:
Description: A polyclonal antibody for detection of PLC ?2 phospho Tyr753) from Human, Mouse, Rat. This PLC ?2 phospho Tyr753) antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human PLC ?2 around the phosphorylation site of Y753

PLC Gamma2 (phospho Tyr753) Polyclonal Antibody

ABP50478-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human PLC ?2 around the phosphorylation site of Y753
  • Applications tips:
Description: A polyclonal antibody for detection of PLC ?2 phospho Tyr753) from Human, Mouse, Rat. This PLC ?2 phospho Tyr753) antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human PLC ?2 around the phosphorylation site of Y753

Phospho-PLCG2 (Tyr753) Antibody

AF3192 200ul
EUR 304
Description: Phospho-PLCG2 (Tyr753) Antibody detects endogenous levels of PLCG2 only when phosphorylated at Tyrosine 753.

Phospho- PLCG2 (Tyr753) Antibody

ABF3192 100 ug
EUR 438

PLCγ2 (Phospho-Tyr753) Antibody

11175-100ul 100ul
EUR 252

PLCγ2 (Phospho-Tyr753) Antibody

11175-50ul 50ul
EUR 187

Phospho-PLCG2 (Tyr753) Antibody

CSB-PA782484-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-PLCG2 (Tyr753). Recognizes Phospho-PLCG2 (Tyr753) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200

Phospho-PLCG2 (Tyr753) Antibody

CSB-PA782484-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-PLCG2 (Tyr753). Recognizes Phospho-PLCG2 (Tyr753) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:1000, IF:1:100-1:200

MERTK (phospho-Tyr753/685) Antibody

13320-100ul 100ul
EUR 252

MERTK (phospho-Tyr753/685) Conjugated Antibody

C13320 100ul
EUR 397

Phospho-PLCG2 (Tyr753) Blocking Peptide

AF3192-BP 1mg
EUR 195

anti-PLCγ2 (Phospho-Tyr753)

LF-PA20416 100 ul
EUR 354
Description: Rabbit polyclonal to PLCγ2 (Phospho-Tyr753)

MerTK/Tyro3 (phospho Tyr749/681) Polyclonal Antibody

ES4477-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MerTK/Tyro3 (phospho Tyr749/681) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

MerTK/Tyro3 (phospho Tyr749/681) Polyclonal Antibody

ES4477-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MerTK/Tyro3 (phospho Tyr749/681) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

MerTK/Tyro3 (phospho Tyr749/681) Polyclonal Antibody

ABP53478-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human MerTK/Tyro3 around the phosphorylation site of Y749/681
  • Applications tips:
Description: A polyclonal antibody for detection of MerTK/Tyro3 phospho Tyr749/681) from Human, Mouse, Rat. This MerTK/Tyro3 phospho Tyr749/681) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MerTK/Tyro3 around the phosphorylation site of Y749/681

MerTK/Tyro3 (phospho Tyr749/681) Polyclonal Antibody

ABP53478-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human MerTK/Tyro3 around the phosphorylation site of Y749/681
  • Applications tips:
Description: A polyclonal antibody for detection of MerTK/Tyro3 phospho Tyr749/681) from Human, Mouse, Rat. This MerTK/Tyro3 phospho Tyr749/681) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MerTK/Tyro3 around the phosphorylation site of Y749/681

MerTK/Tyro3 (phospho Tyr749/681) Polyclonal Antibody

ABP53478-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human MerTK/Tyro3 around the phosphorylation site of Y749/681
  • Applications tips:
Description: A polyclonal antibody for detection of MerTK/Tyro3 phospho Tyr749/681) from Human, Mouse, Rat. This MerTK/Tyro3 phospho Tyr749/681) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MerTK/Tyro3 around the phosphorylation site of Y749/681

MerTK/Tyro3 (Phospho-Tyr749/681) Polyclonal Antibody

12338-100ul 100ul
EUR 252

MerTK/Tyro3 (Phospho-Tyr749/681) Polyclonal Antibody

12338-50ul 50ul
EUR 187

MER/SKY (Phospho-Tyr749/681) Polyclonal Conjugated Antibody

C11740 100ul
EUR 397

Polyclonal TYRO3 Antibody

APR13892G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TYRO3 . This antibody is tested and proven to work in the following applications:

MerTK/Tyro3 (Phospho-Tyr749/681) Polyclonal Polyclonal Conjugated Antibody

C12338 100ul
EUR 397

MER / SKY (Phospho-Tyr749 / 681) Antibody

20-abx012609
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • EUR 70.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • 5 ug
  • Shipped within 5-10 working days.

MER/SKY (Phospho-Tyr749/681) Antibody

11740-100ul 100ul
EUR 252

MER/SKY (Phospho-Tyr749/681) Antibody

11740-50ul 50ul
EUR 187

PLCG2 antibody (Tyr753)

70R-37250 100 ug
EUR 349
Description: Rabbit Polyclonal PLCG2 antibody (Tyr753)

PLCG2 antibody (Tyr753)

70R-31043 100 ug
EUR 327
Description: Rabbit polyclonal PLCG2 antibody (Tyr753)

TYRO3 Rabbit pAb

A12241-100ul 100 ul
EUR 308

TYRO3 Rabbit pAb

A12241-200ul 200 ul
EUR 459

TYRO3 Rabbit pAb

A12241-20ul 20 ul
EUR 183

TYRO3 Rabbit pAb

A12241-50ul 50 ul
EUR 223

TYRO3 Rabbit pAb

A14259-100ul 100 ul
EUR 308

TYRO3 Rabbit pAb

A14259-200ul 200 ul
EUR 459

TYRO3 Rabbit pAb

A14259-20ul 20 ul
EUR 183

TYRO3 Rabbit pAb

A14259-50ul 50 ul
EUR 223

MER antibody

10R-1849 100 ul
EUR 349
Description: Mouse monoclonal MER antibody

MerTK/Tyro3 Polyclonal Antibody

ES2780-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MerTK/Tyro3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MerTK/Tyro3 Polyclonal Antibody

ES2780-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MerTK/Tyro3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MerTK/Tyro3 Polyclonal Antibody

ES4478-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MerTK/Tyro3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

MerTK/Tyro3 Polyclonal Antibody

ES4478-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MerTK/Tyro3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

MerTK/Tyro3 Polyclonal Antibody

ABP53479-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y749/681
  • Applications tips:
Description: A polyclonal antibody for detection of MerTK/Tyro3 from Human, Mouse, Rat. This MerTK/Tyro3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y749/681

MerTK/Tyro3 Polyclonal Antibody

ABP53479-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y749/681
  • Applications tips:
Description: A polyclonal antibody for detection of MerTK/Tyro3 from Human, Mouse, Rat. This MerTK/Tyro3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y749/681

MerTK/Tyro3 Polyclonal Antibody

ABP53479-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y749/681
  • Applications tips:
Description: A polyclonal antibody for detection of MerTK/Tyro3 from Human, Mouse, Rat. This MerTK/Tyro3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y749/681

MerTK/Tyro3 Polyclonal Antibody

ABP51781-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y753/Y685
  • Applications tips:
Description: A polyclonal antibody for detection of MerTK/Tyro3 from Human, Mouse, Rat. This MerTK/Tyro3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y753/Y685

MerTK/Tyro3 Polyclonal Antibody

ABP51781-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y753/Y685
  • Applications tips:
Description: A polyclonal antibody for detection of MerTK/Tyro3 from Human, Mouse, Rat. This MerTK/Tyro3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y753/Y685

MerTK/Tyro3 Polyclonal Antibody

ABP51781-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y753/Y685
  • Applications tips:
Description: A polyclonal antibody for detection of MerTK/Tyro3 from Human, Mouse, Rat. This MerTK/Tyro3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human MerTK/Tyro3 around the non-phosphorylation site of Y753/Y685

TYRO3/MERTK (phospho-Tyr749/681) Antibody

13303-100ul 100ul
EUR 252

Phospho-MERTK/TYRO3 (Y749/681) Antibody

1-CSB-PA006532
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-MERTK/TYRO3 (Y749/681). Recognizes Phospho-MERTK/TYRO3 (Y749/681) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Phospho-MERTK/TYRO3 (Tyr749/681) Antibody

CSB-PA038071-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-MERTK/TYRO3 (Tyr749/681). Recognizes Phospho-MERTK/TYRO3 (Tyr749/681) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Phospho-MERTK/TYRO3 (Tyr749/681) Antibody

CSB-PA038071-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-MERTK/TYRO3 (Tyr749/681). Recognizes Phospho-MERTK/TYRO3 (Tyr749/681) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Anti-MERTK/Mer Rabbit Monoclonal Antibody

M00489 100ug/vial
EUR 397
Description: Rabbit Monoclonal MERTK/Mer Antibody. Validated in IP, IHC, WB and tested in Human.

Phospholipase C Gamma 2 Phospho-Tyr753 (PLCG2 pY753) Antibody

20-abx329059
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospholipase C Gamma 2 Phospho-Tyr753 (PLCG2 pY753) Antibody

abx333144-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Polyclonal TYRO3 Antibody (C-term)

APR13894G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TYRO3 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TYRO3 Antibody (C-term)

APR13895G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TYRO3 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal MER / MERTK Antibody (C-Terminus)

AMM06377G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MER / MERTK (C-Terminus). This antibody is tested and proven to work in the following applications:

Tyro3 Antibody

BF0294 200ul
EUR 376
Description: Tyro3 antibody detects endogenous levels of total Tyro3.

TYRO3 Antibody

ABD13301 100 ug
EUR 438

TYRO3 Antibody

ABD2680 100 ug
EUR 438

TYRO3 Antibody

44890-100ul 100ul
EUR 252

TYRO3 Antibody

44890-50ul 50ul
EUR 187

TYRO3 antibody

10R-6193 100 ul
EUR 691
Description: Mouse monoclonal TYRO3 antibody

TYRO3 antibody

10R-6194 100 ul
EUR 691
Description: Mouse monoclonal TYRO3 antibody

TYRO3 antibody

10R-6195 100 ul
EUR 691
Description: Mouse monoclonal TYRO3 antibody

TYRO3 antibody

10R-6196 100 ul
EUR 691
Description: Mouse monoclonal TYRO3 antibody

TYRO3 antibody

10R-6197 100 ul
EUR 691
Description: Mouse monoclonal TYRO3 antibody

TYRO3 antibody

10R-6198 100 ul
EUR 691
Description: Mouse monoclonal TYRO3 antibody

TYRO3 antibody

10R-6199 100 ul
EUR 726
Description: Mouse monoclonal TYRO3 antibody

TYRO3 antibody

10R-2052 100 ul
EUR 403
Description: Mouse monoclonal TYRO3 antibody

TYRO3 antibody

10R-2105 100 ul
EUR 403
Description: Mouse monoclonal TYRO3 antibody

TYRO3 antibody

10R-2165 100 ul
EUR 403
Description: Mouse monoclonal TYRO3 antibody

TYRO3 Antibody

DF2680 200ul
EUR 304
Description: TYRO3 antibody detects endogenous levels of total TYRO3.

TYRO3 Antibody

1-CSB-PA025396LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TYRO3. Recognizes TYRO3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

TYRO3/MERTK (phospho-Tyr749/681) Conjugated Antibody

C13303 100ul
EUR 397

Anti-Phospho-MerTK/Tyro3 (Y749/681) antibody

STJ90948 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-MerTK/Tyro3 (Y749/681).

Meropenem (MER) Antibody

abx016037-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

PLCG2 (Phospho-Tyr753) Colorimetric Cell-Based ELISA Kit

EKC1995 100ul
EUR 572

Rabbit Tyrosine protein kinase receptor TYRO3(TYRO3) ELISA kit

E04T0746-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tyrosine protein kinase receptor TYRO3(TYRO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tyrosine protein kinase receptor TYRO3(TYRO3) ELISA kit

E04T0746-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tyrosine protein kinase receptor TYRO3(TYRO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tyrosine protein kinase receptor TYRO3(TYRO3) ELISA kit

E04T0746-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tyrosine protein kinase receptor TYRO3(TYRO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Phospho-PLCG2 (Tyr753) Colorimetric Cell-Based ELISA Kit (OKAG01520)

OKAG01520 2 x 96 Wells
EUR 740
Description: Description of target: ;Species reactivity: Human: Y753, Mouse: Y753, Rat: Y753;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: Phospho
Detection Method: Colorimetric 450 nm;Sensitivity:

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody

20-abx126751
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody

20-abx147463
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody

abx033610-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody

abx033610-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody

abx033611-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody

abx033611-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (Tyro3) Antibody

abx012308-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody

abx015715-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (Tyro3) Antibody

abx016061-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody

20-abx302282
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TYRO3 Conjugated Antibody

C44890 100ul
EUR 397

MERTK / TYRO3 Antibody

20-abx327090
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

MERTK / TYRO3 Antibody

20-abx328512
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-TYRO3 Antibody

A00913-1 100ug/vial
EUR 334

MERTK/TYRO3 Antibody

1-CSB-PA003230
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MERTK/TYRO3. Recognizes MERTK/TYRO3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

MERTK/TYRO3 Antibody

1-CSB-PA006534
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MERTK/TYRO3. Recognizes MERTK/TYRO3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

Anti-TYRO3 Antibody

STJ503444 100 µg
EUR 515

Anti-Tyro3 antibody

STJ98440 100 µl
EUR 234
Description: Mouse monoclonal to Tyro3.

Anti-Tyro3 antibody

STJ98441 100 µl
EUR 234
Description: Mouse monoclonal to Tyro3.

Anti-Tyro3 antibody

STJ98442 100 µl
EUR 234
Description: Mouse monoclonal to Tyro3.

Anti-Tyro3 antibody

STJ98443 100 µl
EUR 234
Description: Mouse monoclonal to Tyro3.

Anti-TYRO3 antibody

STJ114132 100 µl
EUR 277
Description: The gene is part of a 3-member transmembrane receptor kinase receptor family with a processed pseudogene distal on chromosome 15. The encoded protein is activated by the products of the growth arrest-specific gene 6 and protein S genes and is involved in controlling cell survival and proliferation, spermatogenesis, immunoregulation and phagocytosis. The encoded protein has also been identified as a cell entry factor for Ebola and Marburg viruses.

Anti-TYRO3 antibody

STJ116472 100 µl
EUR 277
Description: The gene is part of a 3-member transmembrane receptor kinase receptor family with a processed pseudogene distal on chromosome 15. The encoded protein is activated by the products of the growth arrest-specific gene 6 and protein S genes and is involved in controlling cell survival and proliferation, spermatogenesis, immunoregulation and phagocytosis. The encoded protein has also been identified as a cell entry factor for Ebola and Marburg viruses.

Tyro3/ Rat Tyro3 ELISA Kit

ELI-51317r 96 Tests
EUR 886

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody (HRP)

20-abx316068
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody (FITC)

20-abx316069
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Receptor TYRO3 (TYRO3) Antibody (Biotin)

20-abx316070
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

anti-MER (7E5G1)

LF-MA30130 100 ul
EUR 445
Description: Mouse Monoclonal to MER

TYRO3 siRNA

20-abx905891
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TYRO3 siRNA

20-abx938683
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TYRO3 siRNA

20-abx938684
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TYRO3

YF-PA15186 100 ug
EUR 403
Description: Rabbit polyclonal to TYRO3

anti-TYRO3

YF-PA24922 50 ul
EUR 334
Description: Mouse polyclonal to TYRO3

Monoclonal MER Antibody, Clone: 7E5G1

AMM02647G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human MER. The antibodies are raised in Mouse and are from clone 7E5G1. This antibody is applicable in WB, E

MER (Ab-753) Conjugated Antibody

C33314 100ul
EUR 397

PRC1(Phospho-Thr481)Rabbit Polyclonal Antibody

ES8619-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PRC1(Phospho-Thr481)Rabbit from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PRC1(Phospho-Thr481)Rabbit Polyclonal Antibody

ES8619-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PRC1(Phospho-Thr481)Rabbit from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ATM Phospho (Ser1981) Rabbit Polyclonal Antibody

Ab11236-050 50ul
EUR 347

ATM Phospho (Ser1981) Rabbit Polyclonal Antibody

Ab11236-100 100ul
EUR 482

TYRO3 Antibody, HRP conjugated

1-CSB-PA025396LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TYRO3. Recognizes TYRO3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TYRO3 Antibody, FITC conjugated

1-CSB-PA025396LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TYRO3. Recognizes TYRO3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TYRO3 Antibody, Biotin conjugated

1-CSB-PA025396LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TYRO3. Recognizes TYRO3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-MerTK/Tyro3 antibody

STJ94099 200 µl
EUR 197
Description: Rabbit polyclonal to MerTK/Tyro3.

Anti-MerTK/Tyro3 antibody

STJ94100 200 µl
EUR 197
Description: Rabbit polyclonal to MerTK/Tyro3.

Anti-TYRO3 Antibody (Biotin)

STJ503445 100 µg
EUR 586

Anti-TYRO3 Antibody (FITC)

STJ503446 100 µg
EUR 586

Human Mer/MERTK(Tyrosine-protein kinase Mer) ELISA Kit

EH0224 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q12866
  • Alias: Mer/MERTK
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Rabbit Anti-Rabbit SYN1 Polyclonal Antibody, Phospho-Ser9

CPB-795RH 100 ul
EUR 559

Rabbit Anti-Rabbit Th Polyclonal Antibody, Phospho-Ser19

CPB-840RR 100 ul
EUR 559

Rabbit Anti-Rabbit PIK3R1 Polyclonal Antibody, Phospho-Tyr467

CPB-847RH 100 ul
EUR 559

Rabbit Anti-Rabbit ERBB3 Polyclonal Antibody, Phospho-Tyr1328

CPB-848RH 100 ul
EUR 559

Rabbit Anti-Rabbit EIF4G1 Polyclonal Antibody, Phospho-Ser1232

CPB-851RH 100 ul
EUR 559

Rabbit Anti-Rabbit PRKCQ Polyclonal Antibody, Phospho-Ser695

CPB-723RH 100 ul
EUR 559

Rabbit Anti-Rabbit CTNNB1 Polyclonal Antibody, Phospho-Ser33

CPB-758RH 100 ul
EUR 559

Rabbit Anti-Rabbit CTNNB1 Polyclonal Antibody, Phospho-Ser37

CPB-759RH 100 ul
EUR 559

Meropenem (Mer) Protein (BSA)

20-abx651891
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Meropenem (Mer) Protein (OVA)

20-abx651892
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TIP 39 (39 mer)

5-02006 4 x 1mg Ask for price

Human Mer ELISA Kit

55R-1758 1 kit
EUR 671
Description: ELISA kit for detection of Mer in the research laboratory

BSA Conjugated Meropenem (Mer)

4-CPK946Ge11
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 383.5Da
  • Isoelectric Point: Inquire
Description: Recombinant Pan-species Meropenem expressed in: E.coli

OVA Conjugated Meropenem (Mer)

4-CPK946Ge21
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 383.5Da
  • Isoelectric Point: Inquire
Description: Recombinant Pan-species Meropenem expressed in: E.coli

Human Mer ELISA kit

LF-EK50727 1×96T
EUR 659

Tyrosine-Protein Kinase Mer (MERTK) Antibody

20-abx125366
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody

abx033726-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody

abx033726-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody

20-abx008332
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody

20-abx008333
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody

20-abx004167
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody

20-abx015165
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody

20-abx322134
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody

20-abx322182
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody

abx432965-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Tyrosine-Protein Kinase Mer (MERTK) Antibody

abx432966-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Histone H3(Phospho-Thr3) Rabbit Polyclonal Antibody

12083-100ul 100ul
EUR 252

Histone H3(Phospho-Ser10) Rabbit Polyclonal Antibody

12084-100ul 100ul
EUR 252

Histone H3(Phospho-Thr11) Rabbit Polyclonal Antibody

12085-100ul 100ul
EUR 252

Histone H3(Phospho-Ser28) Rabbit Polyclonal Antibody

12086-100ul 100ul
EUR 252

Histone H3(Phospho-Thr32) Rabbit Polyclonal Antibody

12087-100ul 100ul
EUR 252

Histone H3(Phospho-Tyr41) Rabbit Polyclonal Antibody

12088-100ul 100ul
EUR 252

Histone H3(Phospho-Thr45) Rabbit Polyclonal Antibody

12089-100ul 100ul
EUR 252

Histone H3(Phospho-Thr118) Rabbit Polyclonal Antibody

12090-100ul 100ul
EUR 252

Histone H4(Phospho-Ser1) Rabbit Polyclonal Antibody

12091-100ul 100ul
EUR 252

Histone H4(Phospho-Ser47) Rabbit Polyclonal Antibody

12092-100ul 100ul
EUR 252

Histone H4(Phospho-Thr80) Rabbit Polyclonal Antibody

12093-100ul 100ul
EUR 252

Histone H2B(Phospho-Ser32) Rabbit Polyclonal Antibody

12094-100ul 100ul
EUR 252

Histone H2A(Phospho-Ser129) Rabbit Polyclonal Antibody

12095-100ul 100ul
EUR 252

Histone H1(Phospho-Ser1) Rabbit Polyclonal Antibody

12096-100ul 100ul
EUR 252

Histone H1(Phospho-Thr3) Rabbit Polyclonal Antibody

12097-100ul 100ul
EUR 252

Histone H2A.X(Phospho-Thr120) Rabbit Polyclonal Antibody

12099-100ul 100ul
EUR 252

Histone H2A.X(Phospho-Ser139) Rabbit Polyclonal Antibody

12100-100ul 100ul
EUR 252

Histone H2A.X(Phospho-Tyr142) Rabbit Polyclonal Antibody

12101-100ul 100ul
EUR 252

Histone H2B(Phospho-Ser14) Rabbit Polyclonal Antibody

12102-100ul 100ul
EUR 252

C-Mer Proto Oncogene Tyrosine Kinase (MERTK) Polyclonal Antibody (Human)

4-PAE271Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MERTK (Leu587~Leu858)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Mer Proto Oncogene Tyrosine Kinase (MERTK)

Monoclonal Tyro3 Antibody, Clone: 6D6F10

APR10622G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human Tyro3. The antibodies are raised in Mouse and are from clone 6D6F10. This antibody is applicable in ICC, E

Monoclonal TYRO3 Antibody, Clone: 10E11

APR11235G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human TYRO3. The antibodies are raised in Mouse and are from clone 10E11. This antibody is applicable in WB, E

Monoclonal TYRO3 Antibody, Clone: 1C10E8

AMM08413G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human TYRO3. The antibodies are raised in Mouse and are from clone 1C10E8. This antibody is applicable in WB, ICC, E

Monoclonal Tyro3 Antibody, Clone: 1444CT895.86.31

APR13893G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human Tyro3. The antibodies are raised in Mouse and are from clone 1444CT895.86.31. This antibody is applicable in WB, E

MERTK / TYRO3 (Ab-753) Antibody

abx332676-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

MERTK/TYRO3 (Ab-753) Antibody

CSB-PA114581-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MERTK/TYRO3 (Ab-753). Recognizes MERTK/TYRO3 (Ab-753) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

MERTK/TYRO3 (Ab-753) Antibody

CSB-PA114581-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MERTK/TYRO3 (Ab-753). Recognizes MERTK/TYRO3 (Ab-753) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Antibody for Human TYRO3 (pTyr681)

SPC-1092D 0.1ml
EUR 354
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is unconjugated.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-A390 0.1ml
EUR 401
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to ATTO 390.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-A488 0.1ml
EUR 400
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to ATTO 488.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-A565 0.1ml
EUR 400
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to ATTO 565.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-A594 0.1ml
EUR 400
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to ATTO 594.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-A633 0.1ml
EUR 400
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to ATTO 633.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-A655 0.1ml
EUR 400
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to ATTO 655.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-A680 0.1ml
EUR 400
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to ATTO 680.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-A700 0.1ml
EUR 400
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to ATTO 700.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-ALP 0.1ml
EUR 394
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to Alkaline Phosphatase.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-APC 0.1ml
EUR 399
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to APC .

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-APCCY7 0.1ml
EUR 471
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to APC/Cy7.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-BI 0.1ml
EUR 396
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to Biotin.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-DY350 0.1ml
EUR 475
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to Dylight 350.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-DY405 0.1ml
EUR 452
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to Dylight 405.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-DY488 0.1ml
EUR 432
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to Dylight 488.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-DY594 0.1ml
EUR 436
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to Dylight 594.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-DY633 0.1ml
EUR 426
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to Dylight 633.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-FITC 0.1ml
EUR 392
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to FITC.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-HRP 0.1ml
EUR 388
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to HRP.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-P594 0.1ml
EUR 407
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to PE/ATTO 594.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-PCP 0.1ml
EUR 399
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to PerCP.

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-RPE 0.1ml
EUR 397
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to RPE .

Antibody for Human TYRO3 (pTyr681)

SPC-1092D-STR 0.1ml
EUR 398
  • TYRO3 responds to TUB, TULP1, GAS6 and protein S as ligands and regulates cell survival, proliferation, immunoregulation, phagocytosis, cell migration, actin organization, spermatogenesis, platelet aggregation, clot stabilization, memory formation, c
  • Show more
Description: A polyclonal antibody for TYRO3 (pTyr681) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Tyr681 of human Tyro3 (AA678-684). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This TYRO3 (pTyr681) antibody is conjugated to Streptavidin.

Tyro3 Blocking Peptide

BF0294-BP 1mg
EUR 195

TYRO3 cloning plasmid

CSB-CL025396HU1-10ug 10ug
EUR 859
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2673
  • Sequence: atggcgctgaggcggagcatggggcggccggggctcccgccgctgccgctgccgccgccactgcggctcgggctgctgctggcggctctggcttctctgctgctcccggagtccgccgccgcaggtctgaagctcatgggagccccggtgaagctgacagtgtctcaggggcagc
  • Show more
Description: A cloning plasmid for the TYRO3 gene.

TYRO3 cloning plasmid

CSB-CL025396HU2-10ug 10ug
EUR 859
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2673
  • Sequence: atggcgctgaggcggagcatggggcggccggggctcccgccgctgccgctgccgccgccaccgcggctcgggctgctgctggcggctctggcttctctgctgctcccggagtccgccgccgcaggtctgaagctcatgggagccccggtgaagctgacagtgtctcaggggcagc
  • Show more
Description: A cloning plasmid for the TYRO3 gene.

TYRO3 Blocking Peptide

DF2680-BP 1mg
EUR 195

anti-TYRO3 (1C10E8)

LF-MA30113 100 ul
EUR 486
Description: Mouse Monoclonal to TYRO3

anti-TYRO3 (10E11)

LF-MA30274 100 ul
EUR 486
Description: Mouse Monoclonal to TYRO3

anti-Tyro3 (6D6F10)

LF-MA30359 100 ul
EUR 486
Description: Mouse Monoclonal to Tyro3

Anti-TYRO3 (4F6)

YF-MA15996 100 ug
EUR 363
Description: Mouse monoclonal to TYRO3

Histone H3(Phospho-Thr3) Rabbit Polyclonal Polyclonal Conjugated Antibody

C12083 100ul
EUR 397

Histone H3(Phospho-Ser10) Rabbit Polyclonal Polyclonal Conjugated Antibody

C12084 100ul
EUR 397

Histone H3(Phospho-Thr11) Rabbit Polyclonal Polyclonal Conjugated Antibody

C12085 100ul
EUR 397

Histone H3(Phospho-Ser28) Rabbit Polyclonal Polyclonal Conjugated Antibody

C12086 100ul
EUR 397

Histone H4(Phospho-Ser1) Rabbit Polyclonal Polyclonal Conjugated Antibody

C12091 100ul
EUR 397

Histone H2A.X(Phospho-Tyr142) Rabbit Polyclonal Polyclonal Conjugated Antibody

C12101 100ul
EUR 397

Histone H2B(Phospho-Ser14) Rabbit Polyclonal Polyclonal Conjugated Antibody

C12102 100ul
EUR 397

Mouse Tyrosine protein kinase receptor TYRO3(TYRO3) ELISA kit

E03T0746-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tyrosine protein kinase receptor TYRO3(TYRO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tyrosine protein kinase receptor TYRO3(TYRO3) ELISA kit

E03T0746-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tyrosine protein kinase receptor TYRO3(TYRO3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

MER/TYRO3 (Phospho-Tyr753/Tyr685) Rabbit Polyclonal Antibody