LDHD Rabbit Polyclonal Antibody

LDHD Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

LDHD Rabbit Polyclonal Conjugated Antibody

C38105 100ul
EUR 397

LDHD Polyclonal Antibody

EA126-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LDHD from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA

LDHD Polyclonal Antibody

EA126-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LDHD from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA

LDHD Polyclonal Antibody

A65962 100 µg
EUR 570.55
Description: fast delivery possible

LDHD Polyclonal Antibody

ABP57154-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of LDHD from Human, Mouse, Rat. This LDHD antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

LDHD Polyclonal Antibody

ABP57154-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of LDHD from Human, Mouse, Rat. This LDHD antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

LDHD Polyclonal Antibody

ABP57154-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of LDHD from Human, Mouse, Rat. This LDHD antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

LDHD Polyclonal Antibody

ES8153-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LDHD from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

LDHD Polyclonal Antibody

ES8153-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LDHD from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

Human Lactate Dehydrogenase D (LDHD) ELISA Kit

EUR 517
  • Should the Human Lactate Dehydrogenase D (LDHD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lactate Dehydrogenase D (LDHD) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit

EUR 673
  • Should the Human Lactate Dehydrogenase D (LDHD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lactate Dehydrogenase D (LDHD) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit

RDR-LDHD-Hu-48Tests 48 Tests
EUR 544

Human Lactate Dehydrogenase D (LDHD) ELISA Kit

RDR-LDHD-Hu-96Tests 96 Tests
EUR 756

Human Lactate Dehydrogenase D (LDHD) ELISA Kit

RD-LDHD-Hu-48Tests 48 Tests
EUR 521

Human Lactate Dehydrogenase D (LDHD) ELISA Kit

RD-LDHD-Hu-96Tests 96 Tests
EUR 723

LDHD Rabbit pAb

A15965-100ul 100 ul
EUR 308

LDHD Rabbit pAb

A15965-200ul 200 ul
EUR 459

LDHD Rabbit pAb

A15965-20ul 20 ul
EUR 183

LDHD Rabbit pAb

A15965-50ul 50 ul
EUR 223

LDHD Rabbit pAb

A5196-100ul 100 ul
EUR 308

LDHD Rabbit pAb

A5196-200ul 200 ul
EUR 459

LDHD Rabbit pAb

A5196-20ul 20 ul Ask for price

LDHD Rabbit pAb

A5196-50ul 50 ul Ask for price

LDHD antibody

70R-18240 50 ul
EUR 435
Description: Rabbit polyclonal LDHD antibody

LDHD Antibody

43520-100ul 100ul
EUR 252

LDHD Antibody

43877-100ul 100ul
EUR 252

LDHD Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB;WB:1:1000-5000

LDHD Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

LDHD antibody

70R-3502 50 ug
EUR 467
Description: Rabbit polyclonal LDHD antibody raised against the middle region of LDHD

LDHD Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

Polyclonal LDHD Antibody (N-term)

APR05672G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LDHD (N-term). This antibody is tested and proven to work in the following applications:

LDHD Polyclonal Antibody, HRP Conjugated

A65963 100 µg
EUR 570.55
Description: reagents widely cited

LDHD Polyclonal Antibody, FITC Conjugated

A65964 100 µg
EUR 570.55
Description: Ask the seller for details

LDHD Polyclonal Antibody, Biotin Conjugated

A65965 100 µg
EUR 570.55
Description: The best epigenetics products

LDHD Conjugated Antibody

C43520 100ul
EUR 397

LDHD Conjugated Antibody

C43877 100ul
EUR 397

anti- LDHD antibody

FNab04741 100µg
EUR 548.75
  • Immunogen: lactate dehydrogenase D
  • Uniprot ID: Q86WU2
  • Gene ID: 197257
  • Research Area: Metabolism
Description: Antibody raised against LDHD

Anti-LDHD antibody

PAab04741 100 ug
EUR 386

Anti-LDHD antibody

STJ111240 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the D-isomer specific 2-hydroxyacid dehydrogenase family. The similar protein in yeast has both D-lactate and D-glycerate dehydrogenase activities. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified.

Anti-LDHD antibody

STJ118424 100 µl
EUR 277

Anti-LDHD antibody

STJ97199 200 µl
EUR 197
Description: Rabbit polyclonal to LDHD.

Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHD (Arg62~Ala265)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD)


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA22659 50 ug
EUR 363
Description: Mouse polyclonal to LDHD


YF-PA22660 100 ug
EUR 403
Description: Rabbit polyclonal to LDHD

LDHD Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LDHD Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LDHD Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LDHD. Recognizes LDHD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHD (Arg62~Ala265)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with APC.

Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHD (Arg62~Ala265)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with Biotin.

Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHD (Arg62~Ala265)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with Cy3.

Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHD (Arg62~Ala265)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with FITC.

Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHD (Arg62~Ala265)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with HRP.

Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHD (Arg62~Ala265)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with PE.

Rabbit Lactate Dehydrogenase D (LDHD) ELISA Kit

abx362813-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

LDHD Blocking Peptide

33R-5196 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LDHD antibody, catalog no. 70R-3502

LDHD cloning plasmid

CSB-CL801250HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1524
  • Sequence: atggcccgactgctcaggtctgcaacctgggagctgttcccctggaggggctactgctcccagaaggcaaagggagagctctgcagggacttcgtagaggctctgaaggccgtggtgggcggctcccacgtgtccactgccgcggtggtccgagagcagcacgggcgcgatgagt
  • Show more
Description: A cloning plasmid for the LDHD gene.

Lactate Dehydrogenase D (LDHD) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lactate Dehydrogenase D (LDHD) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody

abx145634-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Lactate Dehydrogenase D (LDHD) Antibody

abx032602-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody

abx032602-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody

abx234741-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Lactate Dehydrogenase D (LDHD) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LDHD (Arg62~Ala265)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lactate Dehydrogenase D (LDHD). This antibody is labeled with APC-Cy7.

Lactate Dehydrogenase D (LDHD) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lactate Dehydrogenase D (LDHD) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


ELA-E1698h 96 Tests
EUR 824


EF009653 96 Tests
EUR 689

Human LDHD shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LDHD shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LDHD Recombinant Protein (Human)

RP017650 100 ug Ask for price

LDHD Recombinant Protein (Rat)

RP207959 100 ug Ask for price

LDHD Recombinant Protein (Mouse)

RP147164 100 ug Ask for price


STJ150057 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of D-LDH in Rat serum, plasma and other biological fluids

Ldhd ORF Vector (Rat) (pORF)

ORF069321 1.0 ug DNA
EUR 506

LDHD ORF Vector (Human) (pORF)

ORF005884 1.0 ug DNA
EUR 95

Ldhd ORF Vector (Mouse) (pORF)

ORF049056 1.0 ug DNA
EUR 506

Recombinant Lactate Dehydrogenase D (LDHD)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q86WU2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 51.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Lactate Dehydrogenase D expressed in: E.coli

LDHD ELISA Kit (Mouse) (OKCA02374)

OKCA02374 96 Wells
EUR 846
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 1.17 mU/mL

LDHD ELISA Kit (Human) (OKCD08603)

OKCD08603 96 Wells
EUR 975
Description: Description of target: The exact functions of LDHD remain unknown.The protein encoded by this gene belongs to the D-isomer specific 2-hydroxyacid dehydrogenase family. The similar protein in yeast has both D-lactate and D-glycerate dehydrogenase activities. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.59ng/mL

LDHD ELISA Kit (Human) (OKEH01221)

OKEH01221 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene belongs to the D-isomer specific 2-hydroxyacid dehydrogenase family. The similar protein in yeast has both D-lactate and D-glycerate dehydrogenase activities. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.34 ng/mL

LDHD ELISA Kit (Mouse) (OKEH05369)

OKEH05369 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78U/mL

Human Lactate Dehydrogenase D (LDHD) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ldhd sgRNA CRISPR Lentivector set (Rat)

K6101501 3 x 1.0 ug
EUR 339

Ldhd sgRNA CRISPR Lentivector set (Mouse)

K3138201 3 x 1.0 ug
EUR 339

LDHD sgRNA CRISPR Lentivector set (Human)

K1205801 3 x 1.0 ug
EUR 339

Human Lactate Dehydrogenase D (LDHD) ELISA Kit

abx053234-96tests 96 tests
EUR 754
  • Shipped within 5-10 working days.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Lactate Dehydrogenase D (LDHD) ELISA Kit

abx255322-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Lactate Dehydrogenase D (LDHD) ELISA Kit

abx256875-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Sheep Lactate Dehydrogenase D (LDHD) ELISA Kit

abx257102-96tests 96 tests
EUR 864
  • Shipped within 5-12 working days.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit

abx252339-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Monkey Lactate Dehydrogenase D (LDHD) ELISA Kit

abx359717-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Pig Lactate Dehydrogenase D (LDHD) ELISA Kit

abx361256-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Chicken Lactate Dehydrogenase D (LDHD) ELISA Kit

abx356517-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Lactate Dehydrogenase D (LDHD) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Ldhd sgRNA CRISPR Lentivector (Rat) (Target 1)

K6101502 1.0 ug DNA
EUR 154

Ldhd sgRNA CRISPR Lentivector (Rat) (Target 2)

K6101503 1.0 ug DNA
EUR 154

Ldhd sgRNA CRISPR Lentivector (Rat) (Target 3)

K6101504 1.0 ug DNA
EUR 154

Ldhd sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3138202 1.0 ug DNA
EUR 154

Ldhd sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3138203 1.0 ug DNA
EUR 154

Ldhd sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3138204 1.0 ug DNA
EUR 154

LDHD sgRNA CRISPR Lentivector (Human) (Target 1)

K1205802 1.0 ug DNA
EUR 154

LDHD sgRNA CRISPR Lentivector (Human) (Target 2)

K1205803 1.0 ug DNA
EUR 154

LDHD sgRNA CRISPR Lentivector (Human) (Target 3)

K1205804 1.0 ug DNA
EUR 154

LDHD Protein Vector (Human) (pPB-C-His)

PV023533 500 ng
EUR 329

LDHD Protein Vector (Human) (pPB-N-His)

PV023534 500 ng
EUR 329

LDHD Protein Vector (Human) (pPM-C-HA)

PV023535 500 ng
EUR 329

LDHD Protein Vector (Human) (pPM-C-His)

PV023536 500 ng
EUR 329

LDHD Protein Vector (Rat) (pPB-C-His)

PV277282 500 ng
EUR 603

LDHD Protein Vector (Rat) (pPB-N-His)

PV277283 500 ng
EUR 603

LDHD Protein Vector (Rat) (pPM-C-HA)

PV277284 500 ng
EUR 603

LDHD Protein Vector (Rat) (pPM-C-His)

PV277285 500 ng
EUR 603

LDHD Protein Vector (Mouse) (pPB-C-His)

PV196222 500 ng
EUR 603

LDHD Protein Vector (Mouse) (pPB-N-His)

PV196223 500 ng
EUR 603

LDHD Protein Vector (Mouse) (pPM-C-HA)

PV196224 500 ng
EUR 603

LDHD Protein Vector (Mouse) (pPM-C-His)

PV196225 500 ng
EUR 603

Human Lactate Dehydrogenase D (LDHD) ELISA Kit

SEE130Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lactate Dehydrogenase D (LDHD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lactate Dehydrogenase D (LDHD) in Tissue homogenates, cell lysates and other biological fluids.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit

SEE130Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lactate Dehydrogenase D (LDHD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lactate Dehydrogenase D (LDHD) in Tissue homogenates, cell lysates and other biological fluids.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit

SEE130Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lactate Dehydrogenase D (LDHD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lactate Dehydrogenase D (LDHD) in Tissue homogenates, cell lysates and other biological fluids.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit

SEE130Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lactate Dehydrogenase D (LDHD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lactate Dehydrogenase D (LDHD) in Tissue homogenates, cell lysates and other biological fluids.

Human Lactate Dehydrogenase D (LDHD) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lactate Dehydrogenase D elisa. Alternative names of the recognized antigen: LDH-D
  • DLD
  • Probable D-lactate dehydrogenase, mitochondrial
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lactate Dehydrogenase D (LDHD) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Ldhd 3'UTR Luciferase Stable Cell Line

TU110977 1.0 ml Ask for price

Ldhd 3'UTR GFP Stable Cell Line

TU160977 1.0 ml Ask for price

Ldhd 3'UTR Luciferase Stable Cell Line

TU206998 1.0 ml Ask for price

Ldhd 3'UTR GFP Stable Cell Line

TU256998 1.0 ml Ask for price

LDHD 3'UTR GFP Stable Cell Line

TU062362 1.0 ml
EUR 1394

LDHD 3'UTR Luciferase Stable Cell Line

TU012362 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

LDHD Rabbit Polyclonal Antibody