KCNN4 (SK4) Rabbit Polyclonal Antibody

KCNN4 (SK4) Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

KCNN4 (SK4) Polyclonal Antibody

ABP57338-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of KCNN4 SK4) from Human, Mouse, Rat. This KCNN4 SK4) antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

KCNN4 (SK4) Polyclonal Antibody

ABP57338-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of KCNN4 SK4) from Human, Mouse, Rat. This KCNN4 SK4) antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

KCNN4 (SK4) Polyclonal Antibody

ABP57338-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of KCNN4 SK4) from Human, Mouse, Rat. This KCNN4 SK4) antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

KCNN4 (SK4) Polyclonal Antibody

ES8331-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against KCNN4 (SK4) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

KCNN4 (SK4) Polyclonal Antibody

ES8331-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against KCNN4 (SK4) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

Anti-KCNN4 (SK4) antibody

STJ97585 200 µl
EUR 197
Description: Rabbit polyclonal to KCNN4 (SK4) (A247).

KCNN4 Rabbit pAb

A1974-100ul 100 ul
EUR 308

KCNN4 Rabbit pAb

A1974-200ul 200 ul
EUR 459

KCNN4 Rabbit pAb

A1974-20ul 20 ul
EUR 183

KCNN4 Rabbit pAb

A1974-50ul 50 ul
EUR 223

KCNN4 Antibody

32529-100ul 100ul
EUR 252

KCNN4 Antibody

1-CSB-PA980762
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KCNN4. Recognizes KCNN4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

KCNN4 Antibody

DF4132 200ul
EUR 304
Description: KCNN4 Antibody detects endogenous levels of total KCNN4.

KCNN4 Antibody

DF6727 200ul
EUR 304
Description: KCNN4 Antibody detects endogenous levels of total KCNN4.

KCNN4 Antibody

1-CSB-PA484256
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KCNN4. Recognizes KCNN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

KCNN4 antibody

70R-36033 100 ug
EUR 327
Description: Rabbit polyclonal KCNN4 antibody

KCNN4 antibody

70R-5153 50 ug
EUR 467
Description: Rabbit polyclonal KCNN4 antibody raised against the C terminal of KCNN4

KCNN4 Antibody

1-CSB-PA012086ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against KCNN4. Recognizes KCNN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

KCNN4 Antibody

1-CSB-PA012086ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against KCNN4. Recognizes KCNN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

KCNN4 Antibody

1-CSB-PA009613
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against KCNN4. Recognizes KCNN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

KCNN4 Antibody

ABD4132 100 ug
EUR 438

KCNN4 Antibody

ABD6727 100 ug
EUR 438

Monoclonal KCa3.1 (SK4) (extracellular) Antibody

AMM06066G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human KCa3.1 (SK4) (extracellular). The antibodies are raised in Mouse. This antibody is applicable in WB and IHC, FC, ICC

Polyclonal KCNN4 / KCa3.1 Antibody (aa227-239)

AMM06148G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human KCNN4 / KCa3.1 (aa227-239). This antibody is tested and proven to work in the following applications:

Polyclonal KCNN4 / KCa3.1 Antibody (C-Terminus)

AMM06149G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN4 / KCa3.1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal KCNN4 / KCa3.1 Antibody (N-Terminus)

AMM06150G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN4 / KCa3.1 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal KCNN4 antibody - C-terminal region

AMM06151G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN4 - C-terminal region. This antibody is tested and proven to work in the following applications:

Kcnn4/ Rat Kcnn4 ELISA Kit

ELI-39232r 96 Tests
EUR 886

Anti-KCNN4 Antibody

A01936-2 100ug/vial
EUR 294

anti- KCNN4 antibody

FNab04498 100µg
EUR 585
  • Immunogen: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
  • Uniprot ID: O15554
  • Gene ID: 3783
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against KCNN4

anti- KCNN4 antibody

FNab04499 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • Immunogen: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
  • Uniprot ID: O15554
  • Gene ID: 3783
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against KCNN4

Anti-KCNN4 Antibody

PA1047-1 100ug/vial
EUR 294

Anti-KCNN4 antibody

PAab04498 100 ug
EUR 412

Anti-KCNN4 antibody

STJ24298 100 µl
EUR 277
Description: The protein encoded by this gene is part of a potentially heterotetrameric voltage-independent potassium channel that is activated by intracellular calcium. Activation is followed by membrane hyperpolarization, which promotes calcium influx. The encoded protein may be part of the predominant calcium-activated potassium channel in T-lymphocytes. This gene is similar to other KCNN family potassium channel genes, but it differs enough to possibly be considered as part of a new subfamily.

KCNN4 siRNA

20-abx921302
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KCNN4 siRNA

20-abx921303
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-KCNN4

YF-PA27273 50 ug
EUR 363
Description: Mouse polyclonal to KCNN4

anti-KCNN4

YF-PA27274 100 ug
EUR 403
Description: Rabbit polyclonal to KCNN4

Anti-KCNN4 / KCa3.1 antibody

STJ73601 100 µg
EUR 359

KCNN4 Blocking Peptide

33R-2063 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNN4 antibody, catalog no. 70R-5153

KCNN4 Blocking Peptide

DF4132-BP 1mg
EUR 195

KCNN4 Blocking Peptide

DF6727-BP 1mg
EUR 195

KCNN4 cloning plasmid

CSB-CL012086HU-10ug 10ug
EUR 469
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1284
  • Sequence: atgggcggggatctggtgcttggcctgggggccttgagacgccgaaagcgcttgctggagcaggagaagtctctggccggctgggcactggtgctggcaggaactggcattggactcatggtgctgcatgcagagatgctgtggttcggggggtgctcgtgggcgctctacctgt
  • Show more
Description: A cloning plasmid for the KCNN4 gene.

Recombinant human KCNN4

P1125 100ug Ask for price
  • Uniprot ID: O15554
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human KCNN4

pCMV-SPORT6-KCNN4

PVT13889 2 ug
EUR 391

Human KCNN4 ELISA KIT

ELI-12838h 96 Tests
EUR 824

Mouse Kcnn4 ELISA KIT

ELI-23729m 96 Tests
EUR 865

KCNN4 ELISA KIT|Human

EF010464 96 Tests
EUR 689

Human KCNN4 shRNA Plasmid

20-abx952557
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse KCNN4 shRNA Plasmid

20-abx971166
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KCNN4 Recombinant Protein (Human)

RP016666 100 ug Ask for price

KCNN4 Recombinant Protein (Rat)

RP206936 100 ug Ask for price

KCNN4 Recombinant Protein (Mouse)

RP145310 100 ug Ask for price

KCNN4 Recombinant Protein (Mouse)

RP145313 100 ug Ask for price

Kcnn4 ORF Vector (Rat) (pORF)

ORF068980 1.0 ug DNA
EUR 506

h KCNN4 inducible lentiviral particles

LVP516 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made optional inducible lentiviral particles for expressing human target: KCNN4 (alternative name: IK1, IKCA1, KCA4, KCa3.1, SK4, hIKCa1, hKCa4, hSK4). The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_002250.2. Particles also contains a RFP-Blasticidin dual selection marker.

CFP-KCNN4 fusion lentiviral particles

LVP551-C 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made lentiviral particles expressing afusion target of (CFP-human CLCN2), provided in DMEM medium with 10% FBS and 60ug/ml of polybrene.

RFP-KCNN4 fusion lentiviral particles

LVP551-R 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made lentiviral particles expressing afusion target of (RFP-human CLCN2), provided in DMEM medium with 10% FBS and 60ug/ml of polybrene.

KCNN4 ORF Vector (Human) (pORF)

ORF005556 1.0 ug DNA
EUR 95

Kcnn4 ORF Vector (Mouse) (pORF)

ORF048438 1.0 ug DNA
EUR 506

Kcnn4 ORF Vector (Mouse) (pORF)

ORF048439 1.0 ug DNA
EUR 506

Kcnn4 sgRNA CRISPR Lentivector set (Rat)

K7624001 3 x 1.0 ug
EUR 339

Kcnn4 sgRNA CRISPR Lentivector set (Mouse)

K3793001 3 x 1.0 ug
EUR 339

KCNN4 sgRNA CRISPR Lentivector set (Human)

K1124401 3 x 1.0 ug
EUR 339

Kcnn4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7624002 1.0 ug DNA
EUR 154

Kcnn4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7624003 1.0 ug DNA
EUR 154

Kcnn4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7624004 1.0 ug DNA
EUR 154

Kcnn4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3793002 1.0 ug DNA
EUR 154

Kcnn4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3793003 1.0 ug DNA
EUR 154

Kcnn4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3793004 1.0 ug DNA
EUR 154

KCNN4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1124402 1.0 ug DNA
EUR 154

KCNN4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1124403 1.0 ug DNA
EUR 154

KCNN4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1124404 1.0 ug DNA
EUR 154

KCNN4 Protein Vector (Human) (pPB-C-His)

PV022221 500 ng
EUR 329

KCNN4 Protein Vector (Human) (pPB-N-His)

PV022222 500 ng
EUR 329

KCNN4 Protein Vector (Human) (pPM-C-HA)

PV022223 500 ng
EUR 329

KCNN4 Protein Vector (Human) (pPM-C-His)

PV022224 500 ng
EUR 329

KCNN4 Protein Vector (Rat) (pPB-C-His)

PV275918 500 ng
EUR 603

KCNN4 Protein Vector (Rat) (pPB-N-His)

PV275919 500 ng
EUR 603

KCNN4 Protein Vector (Rat) (pPM-C-HA)

PV275920 500 ng
EUR 603

KCNN4 Protein Vector (Rat) (pPM-C-His)

PV275921 500 ng
EUR 603

KCNN4 Protein Vector (Mouse) (pPB-C-His)

PV193750 500 ng
EUR 603

KCNN4 Protein Vector (Mouse) (pPB-N-His)

PV193751 500 ng
EUR 603

KCNN4 Protein Vector (Mouse) (pPM-C-HA)

PV193752 500 ng
EUR 603

KCNN4 Protein Vector (Mouse) (pPM-C-His)

PV193753 500 ng
EUR 603

KCNN4 Protein Vector (Mouse) (pPB-C-His)

PV193754 500 ng
EUR 603

KCNN4 Protein Vector (Mouse) (pPB-N-His)

PV193755 500 ng
EUR 603

KCNN4 Protein Vector (Mouse) (pPM-C-HA)

PV193756 500 ng
EUR 603

KCNN4 Protein Vector (Mouse) (pPM-C-His)

PV193757 500 ng
EUR 603

Kcnn4 3'UTR Luciferase Stable Cell Line

TU110467 1.0 ml Ask for price

Kcnn4 3'UTR GFP Stable Cell Line

TU160467 1.0 ml Ask for price

Kcnn4 3'UTR Luciferase Stable Cell Line

TU206612 1.0 ml Ask for price

Kcnn4 3'UTR GFP Stable Cell Line

TU256612 1.0 ml Ask for price

KCNN4 3'UTR GFP Stable Cell Line

TU061537 1.0 ml
EUR 1394

KCNN4 3'UTR Luciferase Stable Cell Line

TU011537 1.0 ml
EUR 1394

KCNN4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV654055 1.0 ug DNA
EUR 682

KCNN4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV654059 1.0 ug DNA
EUR 682

KCNN4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV654060 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

KCNN4 (SK4) Rabbit Polyclonal Antibody