KCNN3 (SK3) Rabbit Polyclonal Antibody

KCNN3 (SK3) Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

KCNN3(SK3) Polyclonal Antibody
EA301-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against KCNN3(SK3) from Human/ Rat. This antibody is tested and validated for IHC
KCNN3 (SK3) Polyclonal Antibody
ABP57337-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of KCNN3 SK3) from Human, Rat. This KCNN3 SK3) antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide
KCNN3 (SK3) Polyclonal Antibody
ABP57337-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of KCNN3 SK3) from Human, Rat. This KCNN3 SK3) antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide
KCNN3 (SK3) Polyclonal Antibody
ABP57337-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of KCNN3 SK3) from Human, Rat. This KCNN3 SK3) antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide
KCNN3 (SK3) Polyclonal Antibody
ES8330-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against KCNN3 (SK3) from Human/Rat. This antibody is tested and validated for IHC
KCNN3 (SK3) Polyclonal Antibody
ES8330-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against KCNN3 (SK3) from Human/Rat. This antibody is tested and validated for IHC
Anti-KCNN3 (SK3) Antibody
A03865 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for KCNN3 (SK3) Antibody (KCNN3) detection. Tested with IHC in Human, Rat.
Anti-KCNN3 (SK3) antibody
STJ97584 200 µl
EUR 197
Description: Rabbit polyclonal to KCNN3 (SK3) (A246).
KCNN3 Rabbit pAb
A14012-100ul 100 ul
EUR 308
KCNN3 Rabbit pAb
A14012-200ul 200 ul
EUR 459
KCNN3 Rabbit pAb
A14012-20ul 20 ul
EUR 183
KCNN3 Rabbit pAb
A14012-50ul 50 ul
EUR 223
KCNN3 Rabbit pAb
A6125-100ul 100 ul
EUR 308
KCNN3 Rabbit pAb
A6125-200ul 200 ul
EUR 459
KCNN3 Rabbit pAb
A6125-20ul 20 ul
EUR 183
KCNN3 Rabbit pAb
A6125-50ul 50 ul
EUR 223
KCNN3 antibody
70R-1524 100 ug
EUR 377
Description: Rabbit polyclonal KCNN3 antibody raised against the C terminal of KCNN3
KCNN3 antibody
38722-100ul 100ul
EUR 252
KCNN3 Antibody
1-CSB-PA838540
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:100-200
KCNN3 Antibody
1-CSB-PA880079LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
KCNN3 antibody
70R-5182 50 ug
EUR 467
Description: Rabbit polyclonal KCNN3 antibody raised against the C terminal of KCNN3
Polyclonal KCNN3 antibody - C-terminal region
AMM06147G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN3 - C-terminal region. This antibody is tested and proven to work in the following applications:
Kcnn3/ Rat Kcnn3 ELISA Kit
ELI-15834r 96 Tests
EUR 886
KCNN3 Conjugated Antibody
C38722 100ul
EUR 397
anti- KCNN3 antibody
FNab04497 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IF: 1:50-1:100
  • Immunogen: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
  • Uniprot ID: Q9UGI6
  • Gene ID: 3782
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against KCNN3
Anti-KCNN3 antibody
PAab04497 100 ug
EUR 355
Anti-KCNN3 antibody
STJ27878 100 µl
EUR 277
Description: Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-KCNN3 antibody
STJ115947 100 µl
EUR 277
Description: Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
KCNN3 siRNA
20-abx902817
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KCNN3 siRNA
20-abx921300
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KCNN3 siRNA
20-abx921301
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-KCNN3
YF-PA24045 50 ul
EUR 334
Description: Mouse polyclonal to KCNN3
KCNN3 Antibody, HRP conjugated
1-CSB-PA880079LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
KCNN3 Antibody, FITC conjugated
1-CSB-PA880079LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
KCNN3 Antibody, Biotin conjugated
1-CSB-PA880079LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-CD4 Antibody [SK3], APC-100Tests
QAB10-APC-100Tests 100Tests
EUR 462
Anti-CD4 Antibody [SK3], APC-25Tests
QAB10-APC-25Tests 25Tests
EUR 242
Anti-CD4 Antibody [SK3], APC-500Tests
QAB10-APC-500Tests 500Tests
EUR 1824
Anti-CD4 Antibody [SK3], FITC-100Tests
QAB10-F-100Tests 100Tests
EUR 343
Anti-CD4 Antibody [SK3], FITC-25Tests
QAB10-F-25Tests 25Tests
EUR 216
Anti-CD4 Antibody [SK3], FITC-500Tests
QAB10-F-500Tests 500Tests
EUR 1308
Anti-CD4 Antibody [SK3], PerCP-100Tests
QAB10-PCP-100Tests 100Tests
EUR 487
Anti-CD4 Antibody [SK3], PerCP-25Tests
QAB10-PCP-25Tests 25Tests
EUR 225
Anti-CD4 Antibody [SK3], PerCP-500Tests
QAB10-PCP-500Tests 500Tests
EUR 1909
KCNN3 Blocking Peptide
33R-2149 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNN3 antibody, catalog no. 70R-1524
KCNN3 Blocking Peptide
33R-4172 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNN3 antibody, catalog no. 70R-5182
KCNN3 cloning plasmid
CSB-CL880079HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1281
  • Sequence: atggagagacctataaaggactccatgttttcgttggccctgaaatgccttatcagtctgtccaccatcatccttttgggcttgatcatcgcctaccacacacgtgaagtccagctcttcgtgatcgacaatggcgcggatgactggcggatagccatgacctacgagcgcatcc
  • Show more
Description: A cloning plasmid for the KCNN3 gene.
Anti-CD4 Antibody [SK3], PerCP-Cy5.5-100Tests
QAB10-PCP55-100Tests 100Tests
EUR 555
Anti-CD4 Antibody [SK3], PerCP-Cy5.5-25Tests
QAB10-PCP55-25Tests 25Tests
EUR 259
Anti-CD4 Antibody [SK3], PerCP-Cy5.5-500Tests
QAB10-PCP55-500Tests 500Tests
EUR 2188
Anti-CD4 Antibody [SK3], PE-Cy7-100Tests
QAB10-PE7-100Tests 100Tests
EUR 420
Anti-CD4 Antibody [SK3], PE-Cy7-25Tests
QAB10-PE7-25Tests 25Tests
EUR 242
Anti-CD4 Antibody [SK3], PE-Cy7-500Tests
QAB10-PE7-500Tests 500Tests
EUR 1647
Human KCNN3 ELISA KIT
ELI-19466h 96 Tests
EUR 824
KCNN3 ELISA KIT|Human
EF010463 96 Tests
EUR 689
Rat KCNN3 shRNA Plasmid
20-abx985806
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human KCNN3 shRNA Plasmid
20-abx952556
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse KCNN3 shRNA Plasmid
20-abx980249
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse Kcnn3 ELISA KIT
ELI-38264m 96 Tests
EUR 865
KCNN3 Recombinant Protein (Human)
RP016663 100 ug Ask for price
KCNN3 Recombinant Protein (Rat)
RP206933 100 ug Ask for price
KCNN3 Recombinant Protein (Mouse)
RP145307 100 ug Ask for price
Kcnn3 ORF Vector (Rat) (pORF)
ORF068979 1.0 ug DNA
EUR 506
KCNN3 ORF Vector (Human) (pORF)
ORF005555 1.0 ug DNA
EUR 95
Kcnn3 ORF Vector (Mouse) (pORF)
ORF048437 1.0 ug DNA
EUR 506
pECMV-Kcnn3-m-FLAG Plasmid
PVT15008 2 ug
EUR 325
Kcnn3 sgRNA CRISPR Lentivector set (Rat)
K6932301 3 x 1.0 ug
EUR 339
Kcnn3 sgRNA CRISPR Lentivector set (Mouse)
K4060001 3 x 1.0 ug
EUR 339
KCNN3 sgRNA CRISPR Lentivector set (Human)
K1124301 3 x 1.0 ug
EUR 339
Kcnn3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6932302 1.0 ug DNA
EUR 154
Kcnn3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6932303 1.0 ug DNA
EUR 154
Kcnn3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6932304 1.0 ug DNA
EUR 154
Kcnn3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4060002 1.0 ug DNA
EUR 154
Kcnn3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4060003 1.0 ug DNA
EUR 154
Kcnn3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4060004 1.0 ug DNA
EUR 154
KCNN3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1124302 1.0 ug DNA
EUR 154
KCNN3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1124303 1.0 ug DNA
EUR 154
KCNN3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1124304 1.0 ug DNA
EUR 154
KCNN3 Protein Vector (Human) (pPB-C-His)
PV022217 500 ng
EUR 329
KCNN3 Protein Vector (Human) (pPB-N-His)
PV022218 500 ng
EUR 329
KCNN3 Protein Vector (Human) (pPM-C-HA)
PV022219 500 ng
EUR 329
KCNN3 Protein Vector (Human) (pPM-C-His)
PV022220 500 ng
EUR 329
KCNN3 Protein Vector (Rat) (pPB-C-His)
PV275914 500 ng
EUR 1166
KCNN3 Protein Vector (Rat) (pPB-N-His)
PV275915 500 ng
EUR 1166
KCNN3 Protein Vector (Rat) (pPM-C-HA)
PV275916 500 ng
EUR 1166
KCNN3 Protein Vector (Rat) (pPM-C-His)
PV275917 500 ng
EUR 1166
KCNN3 Protein Vector (Mouse) (pPB-C-His)
PV193746 500 ng
EUR 1065
KCNN3 Protein Vector (Mouse) (pPB-N-His)
PV193747 500 ng
EUR 1065
KCNN3 Protein Vector (Mouse) (pPM-C-HA)
PV193748 500 ng
EUR 1065
KCNN3 Protein Vector (Mouse) (pPM-C-His)
PV193749 500 ng
EUR 1065
Kcnn3 3'UTR Luciferase Stable Cell Line
TU110466 1.0 ml Ask for price
Kcnn3 3'UTR GFP Stable Cell Line
TU160466 1.0 ml Ask for price
Kcnn3 3'UTR Luciferase Stable Cell Line
TU206611 1.0 ml Ask for price
Kcnn3 3'UTR GFP Stable Cell Line
TU256611 1.0 ml Ask for price
KCNN3 3'UTR GFP Stable Cell Line
TU061536 1.0 ml
EUR 1394
KCNN3 3'UTR Luciferase Stable Cell Line
TU011536 1.0 ml
EUR 1394
KCNN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV652327 1.0 ug DNA
EUR 1355
KCNN3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV652331 1.0 ug DNA
EUR 1355
KCNN3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV652332 1.0 ug DNA
EUR 1355
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

KCNN3 (SK3) Rabbit Polyclonal Antibody