KCNN3 (SK3) Rabbit Polyclonal Antibody

KCNN3 (SK3) Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

KCNN3(SK3) Polyclonal Antibody
EA301-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against KCNN3(SK3) from Human/ Rat. This antibody is tested and validated for IHC

KCNN3 (SK3) Polyclonal Antibody
ABP57337-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of KCNN3 SK3) from Human, Rat. This KCNN3 SK3) antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

KCNN3 (SK3) Polyclonal Antibody
ABP57337-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of KCNN3 SK3) from Human, Rat. This KCNN3 SK3) antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

KCNN3 (SK3) Polyclonal Antibody
ABP57337-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic Peptide Applications tips:
Description: A polyclonal antibody for detection of KCNN3 SK3) from Human, Rat. This KCNN3 SK3) antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

KCNN3 (SK3) Polyclonal Antibody
ES8330-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against KCNN3 (SK3) from Human/Rat. This antibody is tested and validated for IHC

KCNN3 (SK3) Polyclonal Antibody
ES8330-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against KCNN3 (SK3) from Human/Rat. This antibody is tested and validated for IHC

Anti-KCNN3 (SK3) Antibody
A03865	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for KCNN3 (SK3) Antibody (KCNN3) detection. Tested with IHC in Human, Rat.

Anti-KCNN3 (SK3) antibody
STJ97584	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to KCNN3 (SK3) (A246).

KCNN3 Rabbit pAb
A14012-100ul	Abclonal	100 ul	EUR 308

KCNN3 Rabbit pAb
A14012-200ul	Abclonal	200 ul	EUR 459

KCNN3 Rabbit pAb
A14012-20ul	Abclonal	20 ul	EUR 183

KCNN3 Rabbit pAb
A14012-50ul	Abclonal	50 ul	EUR 223

KCNN3 Rabbit pAb
A6125-100ul	Abclonal	100 ul	EUR 308

KCNN3 Rabbit pAb
A6125-200ul	Abclonal	200 ul	EUR 459

KCNN3 Rabbit pAb
A6125-20ul	Abclonal	20 ul	EUR 183

KCNN3 Rabbit pAb
A6125-50ul	Abclonal	50 ul	EUR 223

KCNN3 antibody
70R-1524	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal KCNN3 antibody raised against the C terminal of KCNN3

KCNN3 antibody
38722-100ul	SAB	100ul	EUR 252

KCNN3 Antibody
1-CSB-PA838540	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:100-200

KCNN3 Antibody
1-CSB-PA880079LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

KCNN3 antibody
70R-5182	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal KCNN3 antibody raised against the C terminal of KCNN3

Polyclonal KCNN3 antibody - C-terminal region
AMM06147G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNN3 - C-terminal region. This antibody is tested and proven to work in the following applications:

Kcnn3/ Rat Kcnn3 ELISA Kit
ELI-15834r	Lifescience Market	96 Tests	EUR 886

KCNN3 Conjugated Antibody
C38722	SAB	100ul	EUR 397

anti- KCNN3 antibody
FNab04497	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IF: 1:50-1:100 Immunogen: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 Uniprot ID: Q9UGI6 Gene ID: 3782 Research Area: Neuroscience, Developmental biology
Description: Antibody raised against KCNN3

Anti-KCNN3 antibody
PAab04497	Lifescience Market	100 ug	EUR 355

Anti-KCNN3 antibody
STJ27878	St John's Laboratory	100 µl	EUR 277
Description: Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-KCNN3 antibody
STJ115947	St John's Laboratory	100 µl	EUR 277
Description: Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

KCNN3 siRNA
20-abx902817	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KCNN3 siRNA
20-abx921300	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KCNN3 siRNA
20-abx921301	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-KCNN3
YF-PA24045	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to KCNN3

KCNN3 Antibody, HRP conjugated
1-CSB-PA880079LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KCNN3 Antibody, FITC conjugated
1-CSB-PA880079LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KCNN3 Antibody, Biotin conjugated
1-CSB-PA880079LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNN3. Recognizes KCNN3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-CD4 Antibody [SK3], APC-100Tests
QAB10-APC-100Tests	EnQuireBio	100Tests	EUR 462

Anti-CD4 Antibody [SK3], APC-25Tests
QAB10-APC-25Tests	EnQuireBio	25Tests	EUR 242

Anti-CD4 Antibody [SK3], APC-500Tests
QAB10-APC-500Tests	EnQuireBio	500Tests	EUR 1824

Anti-CD4 Antibody [SK3], FITC-100Tests
QAB10-F-100Tests	EnQuireBio	100Tests	EUR 343

Anti-CD4 Antibody [SK3], FITC-25Tests
QAB10-F-25Tests	EnQuireBio	25Tests	EUR 216

Anti-CD4 Antibody [SK3], FITC-500Tests
QAB10-F-500Tests	EnQuireBio	500Tests	EUR 1308

Anti-CD4 Antibody [SK3], PerCP-100Tests
QAB10-PCP-100Tests	EnQuireBio	100Tests	EUR 487

Anti-CD4 Antibody [SK3], PerCP-25Tests
QAB10-PCP-25Tests	EnQuireBio	25Tests	EUR 225

Anti-CD4 Antibody [SK3], PerCP-500Tests
QAB10-PCP-500Tests	EnQuireBio	500Tests	EUR 1909

KCNN3 Blocking Peptide
33R-2149	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNN3 antibody, catalog no. 70R-1524

KCNN3 Blocking Peptide
33R-4172	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNN3 antibody, catalog no. 70R-5182

KCNN3 cloning plasmid
CSB-CL880079HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1281 Sequence: atggagagacctataaaggactccatgttttcgttggccctgaaatgccttatcagtctgtccaccatcatccttttgggcttgatcatcgcctaccacacacgtgaagtccagctcttcgtgatcgacaatggcgcggatgactggcggatagccatgacctacgagcgcatcc Show more
Description: A cloning plasmid for the KCNN3 gene.

Anti-CD4 Antibody [SK3], PerCP-Cy5.5-100Tests
QAB10-PCP55-100Tests	EnQuireBio	100Tests	EUR 555

Anti-CD4 Antibody [SK3], PerCP-Cy5.5-25Tests
QAB10-PCP55-25Tests	EnQuireBio	25Tests	EUR 259

Anti-CD4 Antibody [SK3], PerCP-Cy5.5-500Tests
QAB10-PCP55-500Tests	EnQuireBio	500Tests	EUR 2188

Anti-CD4 Antibody [SK3], PE-Cy7-100Tests
QAB10-PE7-100Tests	EnQuireBio	100Tests	EUR 420

Anti-CD4 Antibody [SK3], PE-Cy7-25Tests
QAB10-PE7-25Tests	EnQuireBio	25Tests	EUR 242

Anti-CD4 Antibody [SK3], PE-Cy7-500Tests
QAB10-PE7-500Tests	EnQuireBio	500Tests	EUR 1647

Human KCNN3 ELISA KIT
ELI-19466h	Lifescience Market	96 Tests	EUR 824

KCNN3 ELISA KIT|Human
EF010463	Lifescience Market	96 Tests	EUR 689

Rat KCNN3 shRNA Plasmid
20-abx985806	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human KCNN3 shRNA Plasmid
20-abx952556	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse KCNN3 shRNA Plasmid
20-abx980249	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Kcnn3 ELISA KIT
ELI-38264m	Lifescience Market	96 Tests	EUR 865

KCNN3 Recombinant Protein (Human)
RP016663	ABM	100 ug	Ask for price

KCNN3 Recombinant Protein (Rat)
RP206933	ABM	100 ug	Ask for price

KCNN3 Recombinant Protein (Mouse)
RP145307	ABM	100 ug	Ask for price

Kcnn3 ORF Vector (Rat) (pORF)
ORF068979	ABM	1.0 ug DNA	EUR 506

KCNN3 ORF Vector (Human) (pORF)
ORF005555	ABM	1.0 ug DNA	EUR 95

Kcnn3 ORF Vector (Mouse) (pORF)
ORF048437	ABM	1.0 ug DNA	EUR 506

pECMV-Kcnn3-m-FLAG Plasmid
PVT15008	Lifescience Market	2 ug	EUR 325

Kcnn3 sgRNA CRISPR Lentivector set (Rat)
K6932301	ABM	3 x 1.0 ug	EUR 339

Kcnn3 sgRNA CRISPR Lentivector set (Mouse)
K4060001	ABM	3 x 1.0 ug	EUR 339

KCNN3 sgRNA CRISPR Lentivector set (Human)
K1124301	ABM	3 x 1.0 ug	EUR 339

Kcnn3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6932302	ABM	1.0 ug DNA	EUR 154

Kcnn3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6932303	ABM	1.0 ug DNA	EUR 154

Kcnn3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6932304	ABM	1.0 ug DNA	EUR 154

Kcnn3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4060002	ABM	1.0 ug DNA	EUR 154

Kcnn3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4060003	ABM	1.0 ug DNA	EUR 154

Kcnn3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4060004	ABM	1.0 ug DNA	EUR 154

KCNN3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1124302	ABM	1.0 ug DNA	EUR 154

KCNN3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1124303	ABM	1.0 ug DNA	EUR 154

KCNN3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1124304	ABM	1.0 ug DNA	EUR 154

KCNN3 Protein Vector (Human) (pPB-C-His)
PV022217	ABM	500 ng	EUR 329

KCNN3 Protein Vector (Human) (pPB-N-His)
PV022218	ABM	500 ng	EUR 329

KCNN3 Protein Vector (Human) (pPM-C-HA)
PV022219	ABM	500 ng	EUR 329

KCNN3 Protein Vector (Human) (pPM-C-His)
PV022220	ABM	500 ng	EUR 329

KCNN3 Protein Vector (Rat) (pPB-C-His)
PV275914	ABM	500 ng	EUR 1166

KCNN3 Protein Vector (Rat) (pPB-N-His)
PV275915	ABM	500 ng	EUR 1166

KCNN3 Protein Vector (Rat) (pPM-C-HA)
PV275916	ABM	500 ng	EUR 1166

KCNN3 Protein Vector (Rat) (pPM-C-His)
PV275917	ABM	500 ng	EUR 1166

KCNN3 Protein Vector (Mouse) (pPB-C-His)
PV193746	ABM	500 ng	EUR 1065

KCNN3 Protein Vector (Mouse) (pPB-N-His)
PV193747	ABM	500 ng	EUR 1065

KCNN3 Protein Vector (Mouse) (pPM-C-HA)
PV193748	ABM	500 ng	EUR 1065

KCNN3 Protein Vector (Mouse) (pPM-C-His)
PV193749	ABM	500 ng	EUR 1065

Kcnn3 3'UTR Luciferase Stable Cell Line
TU110466	ABM	1.0 ml	Ask for price

Kcnn3 3'UTR GFP Stable Cell Line
TU160466	ABM	1.0 ml	Ask for price

Kcnn3 3'UTR Luciferase Stable Cell Line
TU206611	ABM	1.0 ml	Ask for price

Kcnn3 3'UTR GFP Stable Cell Line
TU256611	ABM	1.0 ml	Ask for price

KCNN3 3'UTR GFP Stable Cell Line
TU061536	ABM	1.0 ml	EUR 1394

KCNN3 3'UTR Luciferase Stable Cell Line
TU011536	ABM	1.0 ml	EUR 1394

KCNN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV652327	ABM	1.0 ug DNA	EUR 1355

KCNN3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV652331	ABM	1.0 ug DNA	EUR 1355

KCNN3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV652332	ABM	1.0 ug DNA	EUR 1355

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

KCNN3 (SK3) Rabbit Polyclonal Antibody