FAM48A Rabbit Polyclonal Antibody

FAM48A Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

FAM48A Polyclonal Antibody

ES8546-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FAM48A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FAM48A Polyclonal Antibody

ES8546-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FAM48A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Fam48a/ Rat Fam48a ELISA Kit

ELI-09774r 96 Tests
EUR 886

Anti-FAM48A Antibody

A11433 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for FAM48A Antibody (SUPT20H) detection. Tested with WB in Human, Mouse, Rat.

anti- FAM48A antibody

FNab02986 100µg
EUR 585
  • Immunogen: family with sequence similarity 48, member A
  • Uniprot ID: Q8NEM7
  • Research Area: Developmental biology
Description: Antibody raised against FAM48A

Anti-FAM48A antibody

PAab02986 100 ug
EUR 412

Anti-FAM48A antibody

STJ98659 200 µl
EUR 197
Description: Rabbit polyclonal to FAM48A.

Human Protein FAM48A, FAM48A ELISA KIT

ELI-09807h 96 Tests
EUR 824

Chicken Protein FAM48A, FAM48A ELISA KIT

ELI-47764c 96 Tests
EUR 928

Mouse Protein FAM48A, Fam48a ELISA KIT

ELI-47765m 96 Tests
EUR 865

FAM48A cloning plasmid

CSB-CL818775HU-10ug 10ug
EUR 765
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2340
  • Sequence: atgcaacaagctttagaactagctttggatcgtgcagagtatgtcattgaaagtgcccgacagagacctcctaaaaggaaatacctatcaagtggaagaaaatctgtatttcaaaaactttatgacttgtatattgaagaatgtgaaaaagaacctgaagttaagaaattaagaa
  • Show more
Description: A cloning plasmid for the FAM48A gene.

FAM48A ELISA KIT|Human

EF009537 96 Tests
EUR 689

FAM48A Recombinant Protein (Human)

RP011569 100 ug Ask for price

FAM48A Recombinant Protein (Rat)

RP200663 100 ug Ask for price

FAM48A Recombinant Protein (Mouse)

RP133427 100 ug Ask for price

Fam48a ORF Vector (Rat) (pORF)

ORF066889 1.0 ug DNA
EUR 506

FAM48A ORF Vector (Human) (pORF)

ORF003857 1.0 ug DNA
EUR 95

Fam48a ORF Vector (Mouse) (pORF)

ORF044477 1.0 ug DNA
EUR 506

FAM48A sgRNA CRISPR Lentivector set (Human)

K0723901 3 x 1.0 ug
EUR 339

Fam48a sgRNA CRISPR Lentivector set (Mouse)

K4815301 3 x 1.0 ug
EUR 339

Fam48a sgRNA CRISPR Lentivector set (Rat)

K6431301 3 x 1.0 ug
EUR 339

Family With Sequence Similarity 48 Member A (FAM48A) Antibody

abx340073-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Family With Sequence Similarity 48 Member A (FAM48A) Antibody

abx232986-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

FAM48A sgRNA CRISPR Lentivector (Human) (Target 1)

K0723902 1.0 ug DNA
EUR 154

FAM48A sgRNA CRISPR Lentivector (Human) (Target 2)

K0723903 1.0 ug DNA
EUR 154

FAM48A sgRNA CRISPR Lentivector (Human) (Target 3)

K0723904 1.0 ug DNA
EUR 154

Fam48a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4815302 1.0 ug DNA
EUR 154

Fam48a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4815303 1.0 ug DNA
EUR 154

Fam48a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4815304 1.0 ug DNA
EUR 154

Fam48a sgRNA CRISPR Lentivector (Rat) (Target 1)

K6431302 1.0 ug DNA
EUR 154

Fam48a sgRNA CRISPR Lentivector (Rat) (Target 2)

K6431303 1.0 ug DNA
EUR 154

Fam48a sgRNA CRISPR Lentivector (Rat) (Target 3)

K6431304 1.0 ug DNA
EUR 154

FAM48A Protein Vector (Mouse) (pPB-C-His)

PV177906 500 ng
EUR 603

FAM48A Protein Vector (Mouse) (pPB-N-His)

PV177907 500 ng
EUR 603

FAM48A Protein Vector (Mouse) (pPM-C-HA)

PV177908 500 ng
EUR 603

FAM48A Protein Vector (Mouse) (pPM-C-His)

PV177909 500 ng
EUR 603

FAM48A Protein Vector (Rat) (pPB-C-His)

PV267554 500 ng
EUR 603

FAM48A Protein Vector (Rat) (pPB-N-His)

PV267555 500 ng
EUR 603

FAM48A Protein Vector (Rat) (pPM-C-HA)

PV267556 500 ng
EUR 603

FAM48A Protein Vector (Rat) (pPM-C-His)

PV267557 500 ng
EUR 603

FAM48A Protein Vector (Human) (pPB-C-His)

PV015425 500 ng
EUR 329

FAM48A Protein Vector (Human) (pPB-N-His)

PV015426 500 ng
EUR 329

FAM48A Protein Vector (Human) (pPM-C-HA)

PV015427 500 ng
EUR 329

FAM48A Protein Vector (Human) (pPM-C-His)

PV015428 500 ng
EUR 329

Fam48a 3'UTR GFP Stable Cell Line

TU156273 1.0 ml Ask for price

Fam48a 3'UTR Luciferase Stable Cell Line

TU106273 1.0 ml Ask for price

Fam48a 3'UTR Luciferase Stable Cell Line

TU204372 1.0 ml Ask for price

Fam48a 3'UTR GFP Stable Cell Line

TU254372 1.0 ml Ask for price

FAM48A 3'UTR GFP Stable Cell Line

TU057328 1.0 ml
EUR 1394

FAM48A 3'UTR Luciferase Stable Cell Line

TU007328 1.0 ml
EUR 1394

FAM48A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV658225 1.0 ug DNA
EUR 682

FAM48A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV658229 1.0 ug DNA
EUR 682

FAM48A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV658230 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

FAM48A Rabbit Polyclonal Antibody