ERLIN1/2 Rabbit Polyclonal Antibody

ERLIN1/2 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

ERLIN1/2 Polyclonal Antibody

ABP57514-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from ERLIN1/2 at AA range: 31-80
  • Applications tips:
Description: A polyclonal antibody for detection of ERLIN1/2 from Human, Mouse, Rat. This ERLIN1/2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ERLIN1/2 at AA range: 31-80

ERLIN1/2 Polyclonal Antibody

ES8507-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERLIN1/2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

ERLIN1/2 Polyclonal Antibody

ES8507-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERLIN1/2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

ERLIN1/2 Polyclonal Conjugated Antibody

C46738 100ul
EUR 397

ERLIN1 Polyclonal Antibody

28725-100ul 100ul
EUR 252

ERLIN1 Polyclonal Antibody

28725-50ul 50ul
EUR 187

ERLIN1 Polyclonal Antibody

A58954 100 µg
EUR 570.55
Description: reagents widely cited

ERLIN1 Rabbit pAb

A4440-100ul 100 ul
EUR 308

ERLIN1 Rabbit pAb

A4440-200ul 200 ul
EUR 459

ERLIN1 Rabbit pAb

A4440-20ul 20 ul Ask for price

ERLIN1 Rabbit pAb

A4440-50ul 50 ul Ask for price

ERLIN1 Rabbit pAb

A14843-100ul 100 ul
EUR 308

ERLIN1 Rabbit pAb

A14843-200ul 200 ul
EUR 459

ERLIN1 Rabbit pAb

A14843-20ul 20 ul
EUR 183

ERLIN1 Rabbit pAb

A14843-50ul 50 ul
EUR 223

ERLIN1 Polyclonal Conjugated Antibody

C32000 100ul
EUR 397

ERLIN1 Polyclonal Conjugated Antibody

C28725 100ul
EUR 397

Anti-ERLIN1/2 Antibody

A08034-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ERLIN1/2 Antibody (ERLIN1) detection.tested for IHC, WB in Human, Mouse, Rat.

Anti-ERLIN1/2 antibody

STJ98620 200 µl
EUR 197
Description: Rabbit polyclonal to ERLIN1/2.

Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit

DLR-ERLIN1-Hu-48T 48T
EUR 554
  • Should the Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ER Lipid Raft Associated Protein 1 (ERLIN1) in samples from tissue homogenates or other biological fluids.

Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit

DLR-ERLIN1-Hu-96T 96T
EUR 725
  • Should the Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ER Lipid Raft Associated Protein 1 (ERLIN1) in samples from tissue homogenates or other biological fluids.

Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit

RDR-ERLIN1-Hu-48Tests 48 Tests
EUR 589

Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit

RDR-ERLIN1-Hu-96Tests 96 Tests
EUR 820

Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit

RD-ERLIN1-Hu-48Tests 48 Tests
EUR 563

Human ER Lipid Raft Associated Protein 1 (ERLIN1) ELISA Kit

RD-ERLIN1-Hu-96Tests 96 Tests
EUR 783

ERLIN1 antibody

70R-17143 50 ul
EUR 435
Description: Rabbit polyclonal ERLIN1 antibody

ERLIN1 antibody

32000-100ul 100ul
EUR 252

ERLIN1 antibody

32000-50ul 50ul
EUR 187

ERLIN1 Antibody

DF12983 200ul
EUR 304
Description: ERLIN1 Antibody detects endogenous levels of ERLIN1.

ERLIN1 antibody

70R-7393 50 ug
EUR 467
Description: Rabbit polyclonal ERLIN1 antibody raised against the N terminal of ERLIN1

ERLIN1 Antibody

1-CSB-PA007790GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ERLIN1 Antibody

1-CSB-PA007790LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

ERLIN1 Polyclonal Antibody, Biotin Conjugated

A58955 100 µg
EUR 570.55
Description: Ask the seller for details

ERLIN1 Polyclonal Antibody, FITC Conjugated

A58956 100 µg
EUR 570.55
Description: The best epigenetics products

ERLIN1 Polyclonal Antibody, HRP Conjugated

A58957 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti- ERLIN1 antibody

FNab02848 100µg
EUR 505.25
  • Immunogen: ER lipid raft associated 1
  • Uniprot ID: O75477
  • Gene ID: 10613
  • Research Area: Metabolism
Description: Antibody raised against ERLIN1

Anti-ERLIN1 antibody

PAab02848 100 ug
EUR 355

Anti-ERLIN1 antibody

STJ26674 100 µl
EUR 277
Description: The protein encoded by this gene is part of a protein complex that mediates degradation of inositol 1,4,5-trisphosphate receptors in the endoplasmic reticulum. The encoded protein also binds cholesterol and regulates the SREBP signaling pathway, which promotes cellular cholesterol homeostasis. Defects in this gene have been associated with spastic paraplegia 62.

Anti-ERLIN1 antibody

STJ117043 100 µl
EUR 277
Description: The protein encoded by this gene is part of a protein complex that mediates degradation of inositol 1,4,5-trisphosphate receptors in the endoplasmic reticulum. The encoded protein also binds cholesterol and regulates the SREBP signaling pathway, which promotes cellular cholesterol homeostasis. Defects in this gene have been associated with spastic paraplegia 62.

Rabbit Polyclonal Antibody to Human Topoisomerase I (Rabbit Serum)

TG2012-2 250 ul
EUR 380

Anti-Bcl-2 Rabbit Monoclonal Antibody

M00040-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Bcl-2 Antibody. Validated in IF, WB and tested in Human, Mouse.

ERLIN1 siRNA

20-abx915644
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ERLIN1 siRNA

20-abx915645
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ERLIN1 Antibody, HRP conjugated

1-CSB-PA007790LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ERLIN1 Antibody, FITC conjugated

1-CSB-PA007790LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ERLIN1 Antibody, Biotin conjugated

1-CSB-PA007790LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ERLIN1. Recognizes ERLIN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-KEO4 / ERLIN1 antibody

STJ71953 100 µg
EUR 359

Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348

M00084-2 100uL
EUR 397
Description: Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348 tested in WB, IHC, reactive to Human

ERLIN1 Blocking Peptide

33R-4577 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ERLIN1 antibody, catalog no. 70R-7393

ERLIN1 Blocking Peptide

DF12983-BP 1mg
EUR 195

ERLIN1 cloning plasmid

CSB-CL007790HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1041
  • Sequence: atgactcaagcccgggttctggtggctgcagtggtggggttggtggctgtcctgctctacgcctccatccacaagattgaggagggccatctggctgtgtactacaggggaggagctttactaactagccccagtggaccaggctatcatatcatgttgcctttcattactacgt
  • Show more
Description: A cloning plasmid for the ERLIN1 gene.

ERLIN1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0693103 1.0 ug DNA
EUR 154

Erlin1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6113603 1.0 ug DNA
EUR 154

ERLIN1/2 Rabbit Polyclonal Antibody