EDA Rabbit Polyclonal Antibody

EDA Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

EDA Polyclonal Antibody
ES8383-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EDA from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
EDA Polyclonal Antibody
ABP57390-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human EDA
  • Applications tips:
Description: A polyclonal antibody for detection of EDA from Human, Mouse. This EDA antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human EDA
EDA Polyclonal Antibody
ABP57390-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human EDA
  • Applications tips:
Description: A polyclonal antibody for detection of EDA from Human, Mouse. This EDA antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human EDA
EDA Polyclonal Antibody
ABP57390-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human EDA
  • Applications tips:
Description: A polyclonal antibody for detection of EDA from Human, Mouse. This EDA antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human EDA
EDA Rabbit pAb
A2905-100ul 100 ul
EUR 308
EDA Rabbit pAb
A2905-200ul 200 ul
EUR 459
EDA Rabbit pAb
A2905-20ul 20 ul
EUR 183
EDA Rabbit pAb
A2905-50ul 50 ul
EUR 223
EDA Antibody
ABD7103 100 ug
EUR 438
EDA Antibody
36433-100ul 100ul
EUR 252
EDA antibody
38491-100ul 100ul
EUR 252
EDA Antibody
DF7103 200ul
EUR 304
Description: EDA Antibody detects endogenous levels of total EDA.
EDA Antibody
1-CSB-PA867682
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EDA. Recognizes EDA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC-p:1:100-1:300.ELISA:1/10000
EDA Antibody
1-CSB-PA798103
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDA. Recognizes EDA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
EDA Antibody
1-CSB-PA595868
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDA. Recognizes EDA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
EDA Antibody
1-CSB-PA237120
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDA. Recognizes EDA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:500-1:5000, WB:1:100-1:500
EDA Antibody
1-CSB-PA039309
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDA. Recognizes EDA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
Polyclonal EDA / ED1 Antibody (Internal)
AMM06998G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EDA / ED1 (Internal). This antibody is tested and proven to work in the following applications:
Polyclonal EDA Antibody (N-term)
AMM06999G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EDA (N-term). This antibody is tested and proven to work in the following applications:
Z-Eda-eda-z
20-abx180918
  • EUR 272.00
  • EUR 1107.00
  • EUR 481.00
  • 1 g
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.
Ectodysplasin A (EDA) Polyclonal Antibody (Mouse)
4-PAC452Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDA (Pro141~Thr378)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA)
EDA Conjugated Antibody
C36433 100ul
EUR 397
Anti-EDA Antibody
PB9191 100ug/vial
EUR 294
Anti-EDA Antibody
PA1561 100ug/vial
EUR 294
Anti-EDA antibody
STJ97656 200 µl
EUR 197
Description: Rabbit polyclonal to EDA.
Anti-EDA antibody
STJ23467 100 µl
EUR 277
Description: The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene.
Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), APC
4-PAC452Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDA (Pro141~Thr378)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with APC.
Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), Biotinylated
4-PAC452Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDA (Pro141~Thr378)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with Biotin.
Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), Cy3
4-PAC452Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDA (Pro141~Thr378)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with Cy3.
Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), FITC
4-PAC452Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDA (Pro141~Thr378)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with FITC.
Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), HRP
4-PAC452Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDA (Pro141~Thr378)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with HRP.
Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), PE
4-PAC452Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDA (Pro141~Thr378)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with PE.
EDA siRNA
20-abx914941
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
EDA siRNA
20-abx914942
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Ectodysplasin A (EDA) Antibody
20-abx002133
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ectodysplasin A (EDA) Antibody
20-abx141207
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Ectodysplasin A (EDA) Antibody
20-abx101160
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Ectodysplasin A (EDA) Antibody
abx032775-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ectodysplasin A (EDA) Antibody
abx032775-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
EDA- A1 Receptor Antibody
ABD9056 100 ug
EUR 438
Ectodysplasin A (EDA) Antibody
20-abx326247
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ectodysplasin A (EDA) Antibody
20-abx212344
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ectodysplasin A (EDA) Antibody
20-abx212873
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ectodysplasin A (EDA) Antibody
20-abx212874
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ectodysplasin A (EDA) Antibody
20-abx213608
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
EDA-A1 Receptor Antibody
45677-100ul 100ul
EUR 252
EDA-A1 Receptor Antibody
45677-50ul 50ul
EUR 187
EDA-A1 Receptor Antibody
DF9056 200ul
EUR 304
Description: EDA-A1 Receptor Antibody detects endogenous levels of total EDA-A1 Receptor.
Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC452Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EDA (Pro141~Thr378)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with APC-Cy7.
EDA Blocking Peptide
20-abx061905
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
D-Biotin-EDA
5-02221 250mg Ask for price
D-Biotin-EDA
5-02222 1g Ask for price
EDA cloning plasmid
CSB-CL856433HU-10ug 10ug
EUR 439
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1176
  • Sequence: atgggctacccggaggtggagcgcagggaactcctgcctgcagcagcgccgcgggagcgagggagccagggctgcgggtgtggcggggcccctgcccgggcgggcgaagggaacagctgcctgctcttcctgggtttctttggcctctcgctggccctccacctgctgacgttgt
  • Show more
Description: A cloning plasmid for the EDA gene.
EDA Blocking Peptide
DF7103-BP 1mg
EUR 195
Recombinant human EDA
P1422 100ug Ask for price
  • Uniprot ID: Q92838
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human EDA
Biotin-EDA-Glucose
M1439-10
EUR 153
Biotin-EDA-Glucose
M1439-50
EUR 430
EDA-A1 Receptor Conjugated Antibody
C45677 100ul
EUR 397
EDA-A1 Receptor (EDAR) Antibody
20-abx215064
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human EDA ELISA Kit
ELA-E1976h 96 Tests
EUR 824
EDA ELISA KIT|Human
EF006123 96 Tests
EUR 689
Human EDA shRNA Plasmid
20-abx951321
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse EDA shRNA Plasmid
20-abx970100
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Recombinant Ectodysplasin A (EDA)
4-RPC452Mu01
  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • EUR 772.00
  • EUR 1444.00
  • EUR 490.00
  • EUR 5140.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O54693
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Ectodysplasin A expressed in: E.coli
EDA Recombinant Protein (Human)
RP038695 100 ug Ask for price
EDA Recombinant Protein (Mouse)
RP130802 100 ug Ask for price
EDA Recombinant Protein (Mouse)
RP130805 100 ug Ask for price
EDA Recombinant Protein (Mouse)
RP130808 100 ug Ask for price
EDA Recombinant Protein (Mouse)
RP130811 100 ug Ask for price
EDA Recombinant Protein (Mouse)
RP130814 100 ug Ask for price
EDA Recombinant Protein (Mouse)
RP130817 100 ug Ask for price
EDA Recombinant Protein (Mouse)
RP130820 100 ug Ask for price
EDA Recombinant Protein (Mouse)
RP130823 100 ug Ask for price
EDA Recombinant Protein (Mouse)
RP130826 100 ug Ask for price
Human EDA PicoKine ELISA Kit
EK1856 96 wells
EUR 425
Description: For quantitative detection of human EDA in cell culture supernates, serum and plasma (heparin, EDTA).
Mouse EDA PicoKine ELISA Kit
EK1857 96 wells
EUR 425
Description: For quantitative detection of mouse EDA in cell culture supernates, serum and plasma (heparin, EDTA).
Rat EDA PicoKine ELISA Kit
EK1858 96 wells
EUR 425
Description: For quantitative detection of rat EDA in cell culture supernates, serum and plasma (heparin, EDTA).
Mouse Ectodysplasin A (EDA) Protein
20-abx066379
  • EUR 885.00
  • EUR 328.00
  • EUR 2834.00
  • EUR 1052.00
  • EUR 606.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
EDA-A1 Receptor Blocking Peptide
DF9056-BP 1mg
EUR 195
Eda ORF Vector (Mouse) (pORF)
ORF043602 1.0 ug DNA
EUR 506
Eda ORF Vector (Mouse) (pORF)
ORF043603 1.0 ug DNA
EUR 506
Eda ORF Vector (Mouse) (pORF)
ORF043604 1.0 ug DNA
EUR 506
Eda ORF Vector (Mouse) (pORF)
ORF043605 1.0 ug DNA
EUR 506
Eda ORF Vector (Mouse) (pORF)
ORF043606 1.0 ug DNA
EUR 506
Eda ORF Vector (Mouse) (pORF)
ORF043607 1.0 ug DNA
EUR 506
Eda ORF Vector (Mouse) (pORF)
ORF043608 1.0 ug DNA
EUR 506
Eda ORF Vector (Mouse) (pORF)
ORF043609 1.0 ug DNA
EUR 506
Eda ORF Vector (Mouse) (pORF)
ORF043610 1.0 ug DNA
EUR 506
EDA ORF Vector (Human) (pORF)
ORF012899 1.0 ug DNA
EUR 354
EDA ELISA Kit (Human) (OKBB01270)
OKBB01270 96 Wells
EUR 505
Description: Description of target: Ectodysplasin A (EDA) is a protein that in humans is encoded by the EDA gene. It is mapped to Xq13.1. The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml
Eda ELISA Kit (Mouse) (OKBB01271)
OKBB01271 96 Wells
EUR 505
Description: Description of target: Ectodysplasin A (EDA) is a protein that in humans is encoded by the EDA gene. It is mapped to X C3; X 43.59 cM. The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml
Eda ELISA Kit (Rat) (OKBB01272)
OKBB01272 96 Wells
EUR 505
Description: Description of target: Ectodysplasin A (EDA) is a protein that in humans is encoded by the EDA gene. It is mapped to Xq22. The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. ;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml
EDA ELISA Kit (Mouse) (OKEH03432)
OKEH03432 96 Wells
EUR 740
Description: Description of target: Cytokine which is involved in epithelial-mesenchymal signaling during morphogenesis of ectodermal organs. Functions as a ligand activating the DEATH-domain containing receptors EDAR and EDA2R. Isoform TAA binds only to the receptor EDAR, while isoform TA-A2 binds exclusively to the receptor EDA2R. May also play a role in cell adhesion (PubMed:10534613).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.091 ng/mL
Human Anti-Epstein Barr Virus (EBV/HHV-4) Early antigen (D) IgA ELISA Kit, 96 tests, quantitative
510-255-EDA 1 Kit
EUR 590
Cow Ectodysplasin A (EDA) ELISA Kit
abx519005-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Ectodysplasin A (EDA) ELISA Kit
abx519007-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Mouse Eda/ Ectodysplasin-A ELISA Kit
E0441Mo 1 Kit
EUR 571
Human EDA/ Ectodysplasin-A ELISA Kit
E0754Hu 1 Kit
EUR 571
Human EDA(Ectodysplasin-A) ELISA Kit
EH2028 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q92838
  • Alias: EDA(Ectodysplasin-A)/EDA protein homolog/Tabby protein/ED1/HED/EDA1/EDA2/HED1/ODT1/XHED/ECTD1/XLHED/ED1-A1/ED1-A2/EDA-A1/EDA-A2/STHAGX1/Ectodermal dysplasia protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml
Human Ectodysplasin- A, EDA ELISA KIT
ELI-06345h 96 Tests
EUR 824
Mouse Ectodysplasin- A, Eda ELISA KIT
ELI-06346m 96 Tests
EUR 865
Bovine Ectodysplasin- A, EDA ELISA KIT
ELI-06347b 96 Tests
EUR 928
Mouse Eda(Ectodysplasin-A) ELISA Kit
EM0705 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O54693
  • Alias: Eda/EDA protein homolog/Tabby protein/ED1/HED/EDA1/EDA2/HED1/ODT1/XHED/ECTD1/XLHED/ED1-A1/ED1-A2/EDA-A1/EDA-A2/STHAGX1/Ectodermal dysplasia protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml
EDA sgRNA CRISPR Lentivector set (Human)
K0652801 3 x 1.0 ug
EUR 339
Mouse Ectodysplasin A (EDA) ELISA Kit
abx255053-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Ectodysplasin A (EDA) ELISA Kit
abx251354-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Eda sgRNA CRISPR Lentivector set (Mouse)
K4377201 3 x 1.0 ug
EUR 339
Escherichia coli KHG/KDPG aldolase (eda)
1-CSB-EP359248ENV
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 26.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Escherichia coli KHG/KDPG aldolase(eda) expressed in E.coli
Mouse Ectodysplasin-A(EDA) ELISA kit
CSB-EL007389MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ectodysplasin-A (EDA) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Ectodysplasin-A(EDA) ELISA kit
1-CSB-EL007389MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ectodysplasin-A(EDA) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Ectodysplasin A(EDA)ELISA Kit
QY-E01122 96T
EUR 400
Anti-EDA (clone F8)-SS-DM1 ADC
ADC-W-399 1mg Ask for price
Description: This ADC product is comprised of an anti-EDA monoclonal antibody (clone F8) conjugated via a linker to a DM1
EDA sgRNA CRISPR Lentivector (Human) (Target 1)
K0652802 1.0 ug DNA
EUR 154
EDA sgRNA CRISPR Lentivector (Human) (Target 2)
K0652803 1.0 ug DNA
EUR 154
EDA sgRNA CRISPR Lentivector (Human) (Target 3)
K0652804 1.0 ug DNA
EUR 154
ADP-TAMRA conjugate [5-TAMRA-eda-ADP]
13606 100 nmol
EUR 480
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200
ATP-TAMRA conjugate [5-TAMRA-eda-ATP]
13607 100 nmol
EUR 480
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200
Eda sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4377202 1.0 ug DNA
EUR 154
Eda sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4377203 1.0 ug DNA
EUR 154
Eda sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4377204 1.0 ug DNA
EUR 154
EDA Protein Vector (Human) (pPB-C-His)
PV051593 500 ng
EUR 481
EDA Protein Vector (Human) (pPB-N-His)
PV051594 500 ng
EUR 481
EDA Protein Vector (Human) (pPM-C-HA)
PV051595 500 ng
EUR 481
EDA Protein Vector (Human) (pPM-C-His)
PV051596 500 ng
EUR 481
EDA Protein Vector (Mouse) (pPB-C-His)
PV174406 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPB-N-His)
PV174407 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPM-C-HA)
PV174408 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPM-C-His)
PV174409 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPB-C-His)
PV174410 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPB-N-His)
PV174411 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPM-C-HA)
PV174412 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPM-C-His)
PV174413 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPB-C-His)
PV174414 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPB-N-His)
PV174415 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPM-C-HA)
PV174416 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPM-C-His)
PV174417 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPB-C-His)
PV174418 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPB-N-His)
PV174419 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPM-C-HA)
PV174420 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPM-C-His)
PV174421 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPB-C-His)
PV174422 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPB-N-His)
PV174423 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPM-C-HA)
PV174424 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPM-C-His)
PV174425 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPB-C-His)
PV174426 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPB-N-His)
PV174427 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPM-C-HA)
PV174428 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPM-C-His)
PV174429 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPB-C-His)
PV174430 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPB-N-His)
PV174431 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPM-C-HA)
PV174432 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPM-C-His)
PV174433 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPB-C-His)
PV174434 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPB-N-His)
PV174435 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPM-C-HA)
PV174436 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPM-C-His)
PV174437 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPB-C-His)
PV174438 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPB-N-His)
PV174439 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPM-C-HA)
PV174440 500 ng
EUR 603
EDA Protein Vector (Mouse) (pPM-C-His)
PV174441 500 ng
EUR 603
Eda 3'UTR Luciferase Stable Cell Line
TU203770 1.0 ml Ask for price
Eda 3'UTR GFP Stable Cell Line
TU155590 1.0 ml Ask for price
EDA 3'UTR Luciferase Stable Cell Line
TU006549 1.0 ml
EUR 2333

EDA Rabbit Polyclonal Antibody