EDA Rabbit Polyclonal Antibody

EDA Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

EDA Polyclonal Antibody
ES8383-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against EDA from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

EDA Polyclonal Antibody
ABP57390-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human EDA Applications tips:
Description: A polyclonal antibody for detection of EDA from Human, Mouse. This EDA antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human EDA

EDA Polyclonal Antibody
ABP57390-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human EDA Applications tips:
Description: A polyclonal antibody for detection of EDA from Human, Mouse. This EDA antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human EDA

EDA Polyclonal Antibody
ABP57390-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human EDA Applications tips:
Description: A polyclonal antibody for detection of EDA from Human, Mouse. This EDA antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human EDA

EDA Rabbit pAb
A2905-100ul	Abclonal	100 ul	EUR 308

EDA Rabbit pAb
A2905-200ul	Abclonal	200 ul	EUR 459

EDA Rabbit pAb
A2905-20ul	Abclonal	20 ul	EUR 183

EDA Rabbit pAb
A2905-50ul	Abclonal	50 ul	EUR 223

EDA Antibody
ABD7103	Lifescience Market	100 ug	EUR 438

EDA Antibody
36433-100ul	SAB	100ul	EUR 252

EDA antibody
38491-100ul	SAB	100ul	EUR 252

EDA Antibody
DF7103	Affbiotech	200ul	EUR 304
Description: EDA Antibody detects endogenous levels of total EDA.

EDA Antibody
1-CSB-PA867682	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EDA. Recognizes EDA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC-p:1:100-1:300.ELISA:1/10000

EDA Antibody
1-CSB-PA798103	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDA. Recognizes EDA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

EDA Antibody
1-CSB-PA595868	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDA. Recognizes EDA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

EDA Antibody
1-CSB-PA237120	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDA. Recognizes EDA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:500-1:5000, WB:1:100-1:500

EDA Antibody
1-CSB-PA039309	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EDA. Recognizes EDA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

Polyclonal EDA / ED1 Antibody (Internal)
AMM06998G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EDA / ED1 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal EDA Antibody (N-term)
AMM06999G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EDA (N-term). This antibody is tested and proven to work in the following applications:

Z-Eda-eda-z
20-abx180918	Abbexa	EUR 272.00 EUR 1107.00 EUR 481.00	1 g 25 g 5 g
Shipped within 1-2 weeks.

Ectodysplasin A (EDA) Polyclonal Antibody (Mouse)
4-PAC452Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EDA (Pro141~Thr378) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA)

EDA Conjugated Antibody
C36433	SAB	100ul	EUR 397

Anti-EDA Antibody
PB9191	BosterBio	100ug/vial	EUR 294

Anti-EDA Antibody
PA1561	BosterBio	100ug/vial	EUR 294

Anti-EDA antibody
STJ97656	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to EDA.

Anti-EDA antibody
STJ23467	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene.

Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), APC
4-PAC452Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EDA (Pro141~Thr378) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with APC.

Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), Biotinylated
4-PAC452Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EDA (Pro141~Thr378) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with Biotin.

Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), Cy3
4-PAC452Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EDA (Pro141~Thr378) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with Cy3.

Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), FITC
4-PAC452Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EDA (Pro141~Thr378) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with FITC.

Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), HRP
4-PAC452Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EDA (Pro141~Thr378) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with HRP.

Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), PE
4-PAC452Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EDA (Pro141~Thr378) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with PE.

EDA siRNA
20-abx914941	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EDA siRNA
20-abx914942	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Ectodysplasin A (EDA) Antibody
20-abx002133	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Ectodysplasin A (EDA) Antibody
20-abx141207	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Ectodysplasin A (EDA) Antibody
20-abx101160	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Ectodysplasin A (EDA) Antibody
abx032775-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ectodysplasin A (EDA) Antibody
abx032775-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

EDA- A1 Receptor Antibody
ABD9056	Lifescience Market	100 ug	EUR 438

Ectodysplasin A (EDA) Antibody
20-abx326247	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Ectodysplasin A (EDA) Antibody
20-abx212344	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Ectodysplasin A (EDA) Antibody
20-abx212873	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Ectodysplasin A (EDA) Antibody
20-abx212874	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Ectodysplasin A (EDA) Antibody
20-abx213608	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

EDA-A1 Receptor Antibody
45677-100ul	SAB	100ul	EUR 252

EDA-A1 Receptor Antibody
45677-50ul	SAB	50ul	EUR 187

EDA-A1 Receptor Antibody
DF9056	Affbiotech	200ul	EUR 304
Description: EDA-A1 Receptor Antibody detects endogenous levels of total EDA-A1 Receptor.

Ectodysplasin A (EDA) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC452Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EDA (Pro141~Thr378) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ectodysplasin A (EDA). This antibody is labeled with APC-Cy7.

EDA Blocking Peptide
20-abx061905	Abbexa	EUR 258.00 EUR 384.00	1 mg 5 mg
Shipped within 5-10 working days.

D-Biotin-EDA
5-02221	CHI Scientific	250mg	Ask for price

D-Biotin-EDA
5-02222	CHI Scientific	1g	Ask for price

EDA cloning plasmid
CSB-CL856433HU-10ug	Cusabio	10ug	EUR 439
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1176 Sequence: atgggctacccggaggtggagcgcagggaactcctgcctgcagcagcgccgcgggagcgagggagccagggctgcgggtgtggcggggcccctgcccgggcgggcgaagggaacagctgcctgctcttcctgggtttctttggcctctcgctggccctccacctgctgacgttgt Show more
Description: A cloning plasmid for the EDA gene.

EDA Blocking Peptide
DF7103-BP	Affbiotech	1mg	EUR 195

Recombinant human EDA
P1422	FN Test	100ug	Ask for price
Uniprot ID: Q92838 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human EDA

Biotin-EDA-Glucose
M1439-10	Biovision		EUR 153

Biotin-EDA-Glucose
M1439-50	Biovision		EUR 430

EDA-A1 Receptor Conjugated Antibody
C45677	SAB	100ul	EUR 397

EDA-A1 Receptor (EDAR) Antibody
20-abx215064	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Human EDA ELISA Kit
ELA-E1976h	Lifescience Market	96 Tests	EUR 824

EDA ELISA KIT|Human
EF006123	Lifescience Market	96 Tests	EUR 689

Human EDA shRNA Plasmid
20-abx951321	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse EDA shRNA Plasmid
20-abx970100	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant Ectodysplasin A (EDA)
4-RPC452Mu01	Cloud-Clone	EUR 637.60 EUR 274.00 EUR 2116.00 EUR 772.00 EUR 1444.00 EUR 490.00 EUR 5140.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O54693 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.5kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Ectodysplasin A expressed in: E.coli

EDA Recombinant Protein (Human)
RP038695	ABM	100 ug	Ask for price

EDA Recombinant Protein (Mouse)
RP130802	ABM	100 ug	Ask for price

EDA Recombinant Protein (Mouse)
RP130805	ABM	100 ug	Ask for price

EDA Recombinant Protein (Mouse)
RP130808	ABM	100 ug	Ask for price

EDA Recombinant Protein (Mouse)
RP130811	ABM	100 ug	Ask for price

EDA Recombinant Protein (Mouse)
RP130814	ABM	100 ug	Ask for price

EDA Recombinant Protein (Mouse)
RP130817	ABM	100 ug	Ask for price

EDA Recombinant Protein (Mouse)
RP130820	ABM	100 ug	Ask for price

EDA Recombinant Protein (Mouse)
RP130823	ABM	100 ug	Ask for price

EDA Recombinant Protein (Mouse)
RP130826	ABM	100 ug	Ask for price

Human EDA PicoKine ELISA Kit
EK1856	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human EDA in cell culture supernates, serum and plasma (heparin, EDTA).

Mouse EDA PicoKine ELISA Kit
EK1857	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse EDA in cell culture supernates, serum and plasma (heparin, EDTA).

Rat EDA PicoKine ELISA Kit
EK1858	BosterBio	96 wells	EUR 425
Description: For quantitative detection of rat EDA in cell culture supernates, serum and plasma (heparin, EDTA).

Mouse Ectodysplasin A (EDA) Protein
20-abx066379	Abbexa	EUR 885.00 EUR 328.00 EUR 2834.00 EUR 1052.00 EUR 606.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

EDA-A1 Receptor Blocking Peptide
DF9056-BP	Affbiotech	1mg	EUR 195

Eda ORF Vector (Mouse) (pORF)
ORF043602	ABM	1.0 ug DNA	EUR 506

Eda ORF Vector (Mouse) (pORF)
ORF043603	ABM	1.0 ug DNA	EUR 506

Eda ORF Vector (Mouse) (pORF)
ORF043604	ABM	1.0 ug DNA	EUR 506

Eda ORF Vector (Mouse) (pORF)
ORF043605	ABM	1.0 ug DNA	EUR 506

Eda ORF Vector (Mouse) (pORF)
ORF043606	ABM	1.0 ug DNA	EUR 506

Eda ORF Vector (Mouse) (pORF)
ORF043607	ABM	1.0 ug DNA	EUR 506

Eda ORF Vector (Mouse) (pORF)
ORF043608	ABM	1.0 ug DNA	EUR 506

Eda ORF Vector (Mouse) (pORF)
ORF043609	ABM	1.0 ug DNA	EUR 506

Eda ORF Vector (Mouse) (pORF)
ORF043610	ABM	1.0 ug DNA	EUR 506

EDA ORF Vector (Human) (pORF)
ORF012899	ABM	1.0 ug DNA	EUR 354

EDA ELISA Kit (Human) (OKBB01270)
OKBB01270	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Ectodysplasin A (EDA) is a protein that in humans is encoded by the EDA gene. It is mapped to Xq13.1. The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

Eda ELISA Kit (Mouse) (OKBB01271)
OKBB01271	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Ectodysplasin A (EDA) is a protein that in humans is encoded by the EDA gene. It is mapped to X C3; X 43.59 cM. The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

Eda ELISA Kit (Rat) (OKBB01272)
OKBB01272	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Ectodysplasin A (EDA) is a protein that in humans is encoded by the EDA gene. It is mapped to Xq22. The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. ;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

EDA ELISA Kit (Mouse) (OKEH03432)
OKEH03432	Aviva Systems Biology	96 Wells	EUR 740
Description: Description of target: Cytokine which is involved in epithelial-mesenchymal signaling during morphogenesis of ectodermal organs. Functions as a ligand activating the DEATH-domain containing receptors EDAR and EDA2R. Isoform TAA binds only to the receptor EDAR, while isoform TA-A2 binds exclusively to the receptor EDA2R. May also play a role in cell adhesion (PubMed:10534613).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.091 ng/mL

Human Anti-Epstein Barr Virus (EBV/HHV-4) Early antigen (D) IgA ELISA Kit, 96 tests, quantitative
510-255-EDA	Alpha Diagnostics	1 Kit	EUR 590

Cow Ectodysplasin A (EDA) ELISA Kit
abx519005-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Ectodysplasin A (EDA) ELISA Kit
abx519007-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Mouse Eda/ Ectodysplasin-A ELISA Kit
E0441Mo	Sunlong	1 Kit	EUR 571

Human EDA/ Ectodysplasin-A ELISA Kit
E0754Hu	Sunlong	1 Kit	EUR 571

Human EDA(Ectodysplasin-A) ELISA Kit
EH2028	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: Q92838 Alias: EDA(Ectodysplasin-A)/EDA protein homolog/Tabby protein/ED1/HED/EDA1/EDA2/HED1/ODT1/XHED/ECTD1/XLHED/ED1-A1/ED1-A2/EDA-A1/EDA-A2/STHAGX1/Ectodermal dysplasia protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human Ectodysplasin- A, EDA ELISA KIT
ELI-06345h	Lifescience Market	96 Tests	EUR 824

Mouse Ectodysplasin- A, Eda ELISA KIT
ELI-06346m	Lifescience Market	96 Tests	EUR 865

Bovine Ectodysplasin- A, EDA ELISA KIT
ELI-06347b	Lifescience Market	96 Tests	EUR 928

Mouse Eda(Ectodysplasin-A) ELISA Kit
EM0705	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: O54693 Alias: Eda/EDA protein homolog/Tabby protein/ED1/HED/EDA1/EDA2/HED1/ODT1/XHED/ECTD1/XLHED/ED1-A1/ED1-A2/EDA-A1/EDA-A2/STHAGX1/Ectodermal dysplasia protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

EDA sgRNA CRISPR Lentivector set (Human)
K0652801	ABM	3 x 1.0 ug	EUR 339

Mouse Ectodysplasin A (EDA) ELISA Kit
abx255053-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Ectodysplasin A (EDA) ELISA Kit
abx251354-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Eda sgRNA CRISPR Lentivector set (Mouse)
K4377201	ABM	3 x 1.0 ug	EUR 339

Escherichia coli KHG/KDPG aldolase (eda)
1-CSB-EP359248ENV	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 26.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Escherichia coli KHG/KDPG aldolase(eda) expressed in E.coli

Mouse Ectodysplasin-A(EDA) ELISA kit
CSB-EL007389MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ectodysplasin-A (EDA) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Ectodysplasin-A(EDA) ELISA kit
1-CSB-EL007389MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ectodysplasin-A(EDA) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Ectodysplasin A(EDA)ELISA Kit
QY-E01122	Qayee Biotechnology	96T	EUR 400

Anti-EDA (clone F8)-SS-DM1 ADC
ADC-W-399	Creative Biolabs	1mg	Ask for price
Description: This ADC product is comprised of an anti-EDA monoclonal antibody (clone F8) conjugated via a linker to a DM1

EDA sgRNA CRISPR Lentivector (Human) (Target 1)
K0652802	ABM	1.0 ug DNA	EUR 154

EDA sgRNA CRISPR Lentivector (Human) (Target 2)
K0652803	ABM	1.0 ug DNA	EUR 154

EDA sgRNA CRISPR Lentivector (Human) (Target 3)
K0652804	ABM	1.0 ug DNA	EUR 154

ADP-TAMRA conjugate [5-TAMRA-eda-ADP]
13606	AAT Bioquest	100 nmol	EUR 480
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

ATP-TAMRA conjugate [5-TAMRA-eda-ATP]
13607	AAT Bioquest	100 nmol	EUR 480
R-phrase: R20, R21, R22 H-Phrase: H303, H313, H333 Symbol for dangerous compounds: Xn UNSPEC Code: 12352200

Eda sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4377202	ABM	1.0 ug DNA	EUR 154

Eda sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4377203	ABM	1.0 ug DNA	EUR 154

Eda sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4377204	ABM	1.0 ug DNA	EUR 154

EDA Protein Vector (Human) (pPB-C-His)
PV051593	ABM	500 ng	EUR 481

EDA Protein Vector (Human) (pPB-N-His)
PV051594	ABM	500 ng	EUR 481

EDA Protein Vector (Human) (pPM-C-HA)
PV051595	ABM	500 ng	EUR 481

EDA Protein Vector (Human) (pPM-C-His)
PV051596	ABM	500 ng	EUR 481

EDA Protein Vector (Mouse) (pPB-C-His)
PV174406	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPB-N-His)
PV174407	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPM-C-HA)
PV174408	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPM-C-His)
PV174409	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPB-C-His)
PV174410	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPB-N-His)
PV174411	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPM-C-HA)
PV174412	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPM-C-His)
PV174413	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPB-C-His)
PV174414	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPB-N-His)
PV174415	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPM-C-HA)
PV174416	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPM-C-His)
PV174417	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPB-C-His)
PV174418	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPB-N-His)
PV174419	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPM-C-HA)
PV174420	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPM-C-His)
PV174421	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPB-C-His)
PV174422	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPB-N-His)
PV174423	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPM-C-HA)
PV174424	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPM-C-His)
PV174425	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPB-C-His)
PV174426	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPB-N-His)
PV174427	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPM-C-HA)
PV174428	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPM-C-His)
PV174429	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPB-C-His)
PV174430	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPB-N-His)
PV174431	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPM-C-HA)
PV174432	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPM-C-His)
PV174433	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPB-C-His)
PV174434	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPB-N-His)
PV174435	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPM-C-HA)
PV174436	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPM-C-His)
PV174437	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPB-C-His)
PV174438	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPB-N-His)
PV174439	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPM-C-HA)
PV174440	ABM	500 ng	EUR 603

EDA Protein Vector (Mouse) (pPM-C-His)
PV174441	ABM	500 ng	EUR 603

Eda 3'UTR Luciferase Stable Cell Line
TU203770	ABM	1.0 ml	Ask for price

Eda 3'UTR GFP Stable Cell Line
TU155590	ABM	1.0 ml	Ask for price

EDA 3'UTR Luciferase Stable Cell Line
TU006549	ABM	1.0 ml	EUR 2333

EDA Rabbit Polyclonal Antibody