CYP26B1 Rabbit Polyclonal Antibody

CYP26B1 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

CYP26B1 Polyclonal Antibody
ABP57547-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthetic peptide from human protein at AA range: 391-440 Applications tips:
Description: A polyclonal antibody for detection of CYP26B1 from Human, Mouse, Rat. This CYP26B1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 391-440

CYP26B1 Polyclonal Antibody
ABP57547-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthetic peptide from human protein at AA range: 391-440 Applications tips:
Description: A polyclonal antibody for detection of CYP26B1 from Human, Mouse, Rat. This CYP26B1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 391-440

CYP26B1 Polyclonal Antibody
ABP57547-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic peptide from human protein at AA range: 391-440 Applications tips:
Description: A polyclonal antibody for detection of CYP26B1 from Human, Mouse, Rat. This CYP26B1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 391-440

CYP26B1 Polyclonal Antibody
ES8540-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CYP26B1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CYP26B1 Polyclonal Antibody
ES8540-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CYP26B1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CYP26B1 Rabbit pAb
A12142-100ul	Abclonal	100 ul	EUR 308

CYP26B1 Rabbit pAb
A12142-200ul	Abclonal	200 ul	EUR 459

CYP26B1 Rabbit pAb
A12142-20ul	Abclonal	20 ul	EUR 183

CYP26B1 Rabbit pAb
A12142-50ul	Abclonal	50 ul	EUR 223

Polyclonal CYP26B1 Antibody (Internal)
APG02880G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CYP26B1 (Internal). This antibody is tested and proven to work in the following applications:

CYP26B1 antibody
70R-16708	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CYP26B1 antibody

CYP26B1 Antibody
47001-100ul	SAB	100ul	EUR 252

cyp26b1 Antibody
1-CSB-PA721935LA01DIL	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against cyp26b1. Recognizes cyp26b1 from Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

CYP26B1 Antibody
1-CSB-PA770048	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against CYP26B1. Recognizes CYP26B1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000

CYP26B1 Antibody
DF12194	Affbiotech	200ul	EUR 304
Description: CYP26B1 antibody detects endogenous levels of CYP26B1.

CYP26B1 Antibody
1-CSB-PA006403GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CYP26B1. Recognizes CYP26B1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

CYP26B1 antibody
70R-3226	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CYP26B1 antibody raised against the N terminal of CYP26B1

CYP26B1 antibody
70R-3388	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CYP26B1 antibody raised against the middle region of CYP26B1

Polyclonal CYP26B1 Antibody (internal region)
APG02879G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CYP26B1 (internal region). This antibody is tested and proven to work in the following applications:

CYP26B1 Conjugated Antibody
C47001	SAB	100ul	EUR 397

anti- CYP26B1 antibody
FNab02152	FN Test	100µg	EUR 505.25
Immunogen: cytochrome P450, family 26, subfamily B, polypeptide 1 Uniprot ID: Q9NR63 Gene ID: 56603 Research Area: Metabolism, Developmental biology
Description: Antibody raised against CYP26B1

Anti-CYP26B1 antibody
PAab02152	Lifescience Market	100 ug	EUR 355

Anti-CYP26B1 antibody
STJ114035	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the cytochrome P450 superfamily. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The encoded protein is localized to the endoplasmic reticulum, and functions as a critical regulator of all-trans retinoic acid levels by the specific inactivation of all-trans retinoic acid to hydroxylated forms. Mutations in this gene are associated with radiohumeral fusions and other skeletal and craniofacial anomalies, and increased levels of the encoded protein are associated with atherosclerotic lesions. Alternative splicing results in multiple transcript variants.

Anti-CYP26B1 antibody
STJ71030	St John's Laboratory	100 µg	EUR 359

Anti-CYP26B1 antibody
STJ98653	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to CYP26B1.

Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human)
4-PAD541Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CYP26B1 (Met1~Val512) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1)

CYP26B1 siRNA
20-abx901381	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CYP26B1 siRNA
20-abx913364	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CYP26B1 siRNA
20-abx913365	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

cyp26b1 Antibody, HRP conjugated
1-CSB-PA721935LB01DIL	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against cyp26b1. Recognizes cyp26b1 from Zebrafish. This antibody is HRP conjugated. Tested in the following application: ELISA

cyp26b1 Antibody, FITC conjugated
1-CSB-PA721935LC01DIL	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against cyp26b1. Recognizes cyp26b1 from Zebrafish. This antibody is FITC conjugated. Tested in the following application: ELISA

cyp26b1 Antibody, Biotin conjugated
1-CSB-PA721935LD01DIL	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against cyp26b1. Recognizes cyp26b1 from Zebrafish. This antibody is Biotin conjugated. Tested in the following application: ELISA

Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), APC
4-PAD541Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CYP26B1 (Met1~Val512) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with APC.

Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), Biotinylated
4-PAD541Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CYP26B1 (Met1~Val512) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with Biotin.

Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), Cy3
4-PAD541Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CYP26B1 (Met1~Val512) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with Cy3.

Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), FITC
4-PAD541Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CYP26B1 (Met1~Val512) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with FITC.

Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), HRP
4-PAD541Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CYP26B1 (Met1~Val512) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with HRP.

Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), PE
4-PAD541Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CYP26B1 (Met1~Val512) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with PE.

Rabbit Cytochrome P450 26B1(CYP26B1) ELISA kit
E04C2231-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cytochrome P450 26B1(CYP26B1) ELISA kit
E04C2231-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cytochrome P450 26B1(CYP26B1) ELISA kit
E04C2231-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CYP26B1 Blocking Peptide
33R-5404	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CYP26B1 antibody, catalog no. 70R-3226

CYP26B1 Blocking Peptide
33R-8748	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CYP26B1 antibody, catalog no. 70R-3388

CYP26B1 Blocking Peptide
DF12194-BP	Affbiotech	1mg	EUR 195

CYP26B1 cloning plasmid
CSB-CL885700HU1-10ug	Cusabio	10ug	EUR 541
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1539 Sequence: atgctctttgagggcttggatctggtgtcggcgctggccaccctcgccgcgtgcctggtgtccgtgacgctgctgctggccgtgtcgcagcagctgtggcagctgcgctgggccgccactcgcgacaagagctgcaagctgcccatccccaagggatccatgggcttcccgctca Show more
Description: A cloning plasmid for the CYP26B1 gene.

CYP26B1 cloning plasmid
CSB-CL885700HU2-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1539 Sequence: ATGCTCTTTGAGGGCTTGGATCTGGTGTCGGCGCTGGCCACCCTCGCCGCGTGCCTGGTGTCCGTGACGCTGCTGCTGGCCGTGTCGCAGCAGCTGTGGCAGCTGCGCTGGGCCGCCACTCGCGACAAGAGCTGCAAGCTGCCCATCCCCAAGGGATCCATGGGCTTCCCGCTCA Show more
Description: A cloning plasmid for the CYP26B1 gene.

Cytochrome P450 26B1 (CYP26B1) Antibody
20-abx111930	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Cytochrome P450 26B1 (CYP26B1) Antibody
20-abx125740	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Cytochrome P450 26B1 (CYP26B1) Antibody
20-abx128863	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Cytochrome P450 26B1 (CYP26B1) Antibody
20-abx329783	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Cytochrome P450 26B1 (CYP26B1) Antibody
abx431758-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Cytochrome P450 26B1 (CYP26B1) Antibody
abx232152-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), APC-Cy7
4-PAD541Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CYP26B1 (Met1~Val512) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with APC-Cy7.

CYP26B1 ELISA KIT|Human
EF008960	Lifescience Market	96 Tests	EUR 689

Rat CYP26B1 shRNA Plasmid
20-abx989722	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CYP26B1 shRNA Plasmid
20-abx961148	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse CYP26B1 shRNA Plasmid
20-abx981948	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CYP26B1 Recombinant Protein (Human)
RP038392	ABM	100 ug	Ask for price

CYP26B1 Recombinant Protein (Human)
RP008614	ABM	100 ug	Ask for price

CYP26B1 Recombinant Protein (Rat)
RP197060	ABM	100 ug	Ask for price

CYP26B1 Recombinant Protein (Mouse)
RP127088	ABM	100 ug	Ask for price

CYP26B1 Recombinant Protein (Mouse)
RP127091	ABM	100 ug	Ask for price

Cyp26b1 ORF Vector (Rat) (pORF)
ORF065688	ABM	1.0 ug DNA	EUR 506

CYP26B1 ORF Vector (Human) (pORF)
ORF002872	ABM	1.0 ug DNA	EUR 95

CYP26B1 ORF Vector (Human) (pORF)
ORF012798	ABM	1.0 ug DNA	EUR 354

Cyp26b1 ORF Vector (Mouse) (pORF)
ORF042364	ABM	1.0 ug DNA	EUR 506

Cyp26b1 ORF Vector (Mouse) (pORF)
ORF042365	ABM	1.0 ug DNA	EUR 506

Recombinant Cytochrome P450 26B1 (CYP26B1)
4-RPD541Hu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9NR63 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 61.3kDa Isoelectric Point: 8.8
Description: Recombinant Human Cytochrome P450 26B1 expressed in: E.coli

Human Cytochrome P450 26B1 (CYP26B1) Protein
20-abx168263	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CYP26B1 sgRNA CRISPR Lentivector set (Human)
K0556101	ABM	3 x 1.0 ug	EUR 339

Cyp26b1 sgRNA CRISPR Lentivector set (Rat)
K7255101	ABM	3 x 1.0 ug	EUR 339

Cyp26b1 sgRNA CRISPR Lentivector set (Mouse)
K4251501	ABM	3 x 1.0 ug	EUR 339

Rat Cytochrome P450 26B1(CYP26B1) ELISA kit
E02C2231-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cytochrome P450 26B1(CYP26B1) ELISA kit
E02C2231-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cytochrome P450 26B1(CYP26B1) ELISA kit
E02C2231-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome P450 26B1(CYP26B1) ELISA kit
E03C2231-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome P450 26B1(CYP26B1) ELISA kit
E03C2231-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytochrome P450 26B1(CYP26B1) ELISA kit
E03C2231-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cytochrome P450 26B1(CYP26B1) ELISA kit
E06C2231-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cytochrome P450 26B1(CYP26B1) ELISA kit
E06C2231-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cytochrome P450 26B1(CYP26B1) ELISA kit
E06C2231-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytochrome P450 26B1(CYP26B1) ELISA kit
E01C2231-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytochrome P450 26B1(CYP26B1) ELISA kit
E01C2231-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cytochrome P450 26B1(CYP26B1) ELISA kit
E01C2231-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cytochrome P450 26B1(CYP26B1) ELISA kit
E09C2231-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cytochrome P450 26B1(CYP26B1) ELISA kit
E09C2231-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CYP26B1 Rabbit Polyclonal Antibody