CYP26B1 Rabbit Polyclonal Antibody

CYP26B1 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

CYP26B1 Polyclonal Antibody
ABP57547-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic peptide from human protein at AA range: 391-440
  • Applications tips:
Description: A polyclonal antibody for detection of CYP26B1 from Human, Mouse, Rat. This CYP26B1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 391-440
CYP26B1 Polyclonal Antibody
ABP57547-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 391-440
  • Applications tips:
Description: A polyclonal antibody for detection of CYP26B1 from Human, Mouse, Rat. This CYP26B1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 391-440
CYP26B1 Polyclonal Antibody
ABP57547-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 391-440
  • Applications tips:
Description: A polyclonal antibody for detection of CYP26B1 from Human, Mouse, Rat. This CYP26B1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 391-440
CYP26B1 Polyclonal Antibody
ES8540-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CYP26B1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
CYP26B1 Polyclonal Antibody
ES8540-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CYP26B1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
CYP26B1 Rabbit pAb
A12142-100ul 100 ul
EUR 308
CYP26B1 Rabbit pAb
A12142-200ul 200 ul
EUR 459
CYP26B1 Rabbit pAb
A12142-20ul 20 ul
EUR 183
CYP26B1 Rabbit pAb
A12142-50ul 50 ul
EUR 223
Polyclonal CYP26B1 Antibody (Internal)
APG02880G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CYP26B1 (Internal). This antibody is tested and proven to work in the following applications:
CYP26B1 antibody
70R-16708 50 ul
EUR 435
Description: Rabbit polyclonal CYP26B1 antibody
CYP26B1 Antibody
47001-100ul 100ul
EUR 252
cyp26b1 Antibody
1-CSB-PA721935LA01DIL
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against cyp26b1. Recognizes cyp26b1 from Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
CYP26B1 Antibody
1-CSB-PA770048
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against CYP26B1. Recognizes CYP26B1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000
CYP26B1 Antibody
DF12194 200ul
EUR 304
Description: CYP26B1 antibody detects endogenous levels of CYP26B1.
CYP26B1 Antibody
1-CSB-PA006403GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CYP26B1. Recognizes CYP26B1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
CYP26B1 antibody
70R-3226 50 ug
EUR 467
Description: Rabbit polyclonal CYP26B1 antibody raised against the N terminal of CYP26B1
CYP26B1 antibody
70R-3388 50 ug
EUR 467
Description: Rabbit polyclonal CYP26B1 antibody raised against the middle region of CYP26B1
Polyclonal CYP26B1 Antibody (internal region)
APG02879G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CYP26B1 (internal region). This antibody is tested and proven to work in the following applications:
CYP26B1 Conjugated Antibody
C47001 100ul
EUR 397
anti- CYP26B1 antibody
FNab02152 100µg
EUR 505.25
  • Immunogen: cytochrome P450, family 26, subfamily B, polypeptide 1
  • Uniprot ID: Q9NR63
  • Gene ID: 56603
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against CYP26B1
Anti-CYP26B1 antibody
PAab02152 100 ug
EUR 355
Anti-CYP26B1 antibody
STJ114035 100 µl
EUR 277
Description: This gene encodes a member of the cytochrome P450 superfamily. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The encoded protein is localized to the endoplasmic reticulum, and functions as a critical regulator of all-trans retinoic acid levels by the specific inactivation of all-trans retinoic acid to hydroxylated forms. Mutations in this gene are associated with radiohumeral fusions and other skeletal and craniofacial anomalies, and increased levels of the encoded protein are associated with atherosclerotic lesions. Alternative splicing results in multiple transcript variants.
Anti-CYP26B1 antibody
STJ71030 100 µg
EUR 359
Anti-CYP26B1 antibody
STJ98653 200 µl
EUR 197
Description: Rabbit polyclonal to CYP26B1.
Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human)
4-PAD541Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYP26B1 (Met1~Val512)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1)
CYP26B1 siRNA
20-abx901381
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CYP26B1 siRNA
20-abx913364
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CYP26B1 siRNA
20-abx913365
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
cyp26b1 Antibody, HRP conjugated
1-CSB-PA721935LB01DIL
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against cyp26b1. Recognizes cyp26b1 from Zebrafish. This antibody is HRP conjugated. Tested in the following application: ELISA
cyp26b1 Antibody, FITC conjugated
1-CSB-PA721935LC01DIL
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against cyp26b1. Recognizes cyp26b1 from Zebrafish. This antibody is FITC conjugated. Tested in the following application: ELISA
cyp26b1 Antibody, Biotin conjugated
1-CSB-PA721935LD01DIL
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against cyp26b1. Recognizes cyp26b1 from Zebrafish. This antibody is Biotin conjugated. Tested in the following application: ELISA
Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), APC
4-PAD541Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYP26B1 (Met1~Val512)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with APC.
Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), Biotinylated
4-PAD541Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYP26B1 (Met1~Val512)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with Biotin.
Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), Cy3
4-PAD541Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYP26B1 (Met1~Val512)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with Cy3.
Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), FITC
4-PAD541Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYP26B1 (Met1~Val512)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with FITC.
Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), HRP
4-PAD541Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYP26B1 (Met1~Val512)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with HRP.
Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), PE
4-PAD541Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYP26B1 (Met1~Val512)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with PE.
Rabbit Cytochrome P450 26B1(CYP26B1) ELISA kit
E04C2231-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Cytochrome P450 26B1(CYP26B1) ELISA kit
E04C2231-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Cytochrome P450 26B1(CYP26B1) ELISA kit
E04C2231-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
CYP26B1 Blocking Peptide
33R-5404 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CYP26B1 antibody, catalog no. 70R-3226
CYP26B1 Blocking Peptide
33R-8748 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CYP26B1 antibody, catalog no. 70R-3388
CYP26B1 Blocking Peptide
DF12194-BP 1mg
EUR 195
CYP26B1 cloning plasmid
CSB-CL885700HU1-10ug 10ug
EUR 541
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1539
  • Sequence: atgctctttgagggcttggatctggtgtcggcgctggccaccctcgccgcgtgcctggtgtccgtgacgctgctgctggccgtgtcgcagcagctgtggcagctgcgctgggccgccactcgcgacaagagctgcaagctgcccatccccaagggatccatgggcttcccgctca
  • Show more
Description: A cloning plasmid for the CYP26B1 gene.
CYP26B1 cloning plasmid
CSB-CL885700HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1539
  • Sequence: ATGCTCTTTGAGGGCTTGGATCTGGTGTCGGCGCTGGCCACCCTCGCCGCGTGCCTGGTGTCCGTGACGCTGCTGCTGGCCGTGTCGCAGCAGCTGTGGCAGCTGCGCTGGGCCGCCACTCGCGACAAGAGCTGCAAGCTGCCCATCCCCAAGGGATCCATGGGCTTCCCGCTCA
  • Show more
Description: A cloning plasmid for the CYP26B1 gene.
Cytochrome P450 26B1 (CYP26B1) Antibody
20-abx111930
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Cytochrome P450 26B1 (CYP26B1) Antibody
20-abx125740
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Cytochrome P450 26B1 (CYP26B1) Antibody
20-abx128863
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Cytochrome P450 26B1 (CYP26B1) Antibody
20-abx329783
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Cytochrome P450 26B1 (CYP26B1) Antibody
abx431758-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Cytochrome P450 26B1 (CYP26B1) Antibody
abx232152-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Cytochrome P450 26B1 (CYP26B1) Polyclonal Antibody (Human), APC-Cy7
4-PAD541Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CYP26B1 (Met1~Val512)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cytochrome P450 26B1 (CYP26B1). This antibody is labeled with APC-Cy7.
CYP26B1 ELISA KIT|Human
EF008960 96 Tests
EUR 689
Rat CYP26B1 shRNA Plasmid
20-abx989722
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CYP26B1 shRNA Plasmid
20-abx961148
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse CYP26B1 shRNA Plasmid
20-abx981948
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CYP26B1 Recombinant Protein (Human)
RP038392 100 ug Ask for price
CYP26B1 Recombinant Protein (Human)
RP008614 100 ug Ask for price
CYP26B1 Recombinant Protein (Rat)
RP197060 100 ug Ask for price
CYP26B1 Recombinant Protein (Mouse)
RP127088 100 ug Ask for price
CYP26B1 Recombinant Protein (Mouse)
RP127091 100 ug Ask for price
Cyp26b1 ORF Vector (Rat) (pORF)
ORF065688 1.0 ug DNA
EUR 506
CYP26B1 ORF Vector (Human) (pORF)
ORF002872 1.0 ug DNA
EUR 95
CYP26B1 ORF Vector (Human) (pORF)
ORF012798 1.0 ug DNA
EUR 354
Cyp26b1 ORF Vector (Mouse) (pORF)
ORF042364 1.0 ug DNA
EUR 506
Cyp26b1 ORF Vector (Mouse) (pORF)
ORF042365 1.0 ug DNA
EUR 506
Recombinant Cytochrome P450 26B1 (CYP26B1)
4-RPD541Hu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9NR63
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 61.3kDa
  • Isoelectric Point: 8.8
Description: Recombinant Human Cytochrome P450 26B1 expressed in: E.coli
Human Cytochrome P450 26B1 (CYP26B1) Protein
20-abx168263
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
CYP26B1 sgRNA CRISPR Lentivector set (Human)
K0556101 3 x 1.0 ug
EUR 339
Cyp26b1 sgRNA CRISPR Lentivector set (Rat)
K7255101 3 x 1.0 ug
EUR 339
Cyp26b1 sgRNA CRISPR Lentivector set (Mouse)
K4251501 3 x 1.0 ug
EUR 339
Rat Cytochrome P450 26B1(CYP26B1) ELISA kit
E02C2231-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Cytochrome P450 26B1(CYP26B1) ELISA kit
E02C2231-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Cytochrome P450 26B1(CYP26B1) ELISA kit
E02C2231-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cytochrome P450 26B1(CYP26B1) ELISA kit
E03C2231-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cytochrome P450 26B1(CYP26B1) ELISA kit
E03C2231-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cytochrome P450 26B1(CYP26B1) ELISA kit
E03C2231-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Cytochrome P450 26B1(CYP26B1) ELISA kit
E06C2231-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Cytochrome P450 26B1(CYP26B1) ELISA kit
E06C2231-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Cytochrome P450 26B1(CYP26B1) ELISA kit
E06C2231-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytochrome P450 26B1(CYP26B1) ELISA kit
E01C2231-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytochrome P450 26B1(CYP26B1) ELISA kit
E01C2231-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cytochrome P450 26B1(CYP26B1) ELISA kit
E01C2231-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytochrome P450 26B1(CYP26B1) ELISA kit
E09C2231-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cytochrome P450 26B1(CYP26B1) ELISA kit
E09C2231-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cytochrome P450 26B1(CYP26B1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CYP26B1 Rabbit Polyclonal Antibody