CYFIP2 Rabbit Polyclonal Antibody

CYFIP2 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

CYFIP2 Polyclonal Antibody
46735-50ul 50ul
EUR 187
CYFIP2 Polyclonal Antibody
ABP57507-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from CYFIP2 at AA range: 1171-1220
  • Applications tips:
Description: A polyclonal antibody for detection of CYFIP2 from Human, Mouse, Rat. This CYFIP2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from CYFIP2 at AA range: 1171-1220
CYFIP2 Polyclonal Antibody
ABP57507-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from CYFIP2 at AA range: 1171-1220
  • Applications tips:
Description: A polyclonal antibody for detection of CYFIP2 from Human, Mouse, Rat. This CYFIP2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from CYFIP2 at AA range: 1171-1220
CYFIP2 Polyclonal Antibody
ABP57507-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from CYFIP2 at AA range: 1171-1220
  • Applications tips:
Description: A polyclonal antibody for detection of CYFIP2 from Human, Mouse, Rat. This CYFIP2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from CYFIP2 at AA range: 1171-1220
CYFIP2 Polyclonal Antibody
ES8500-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CYFIP2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
CYFIP2 Polyclonal Antibody
ES8500-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CYFIP2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
CYFIP2 Polyclonal Conjugated Antibody
C46735 100ul
EUR 397
CYFIP2 antibody
22012-100ul 100ul
EUR 390
CYFIP2 antibody
70R-16698 50 ul
EUR 435
Description: Rabbit polyclonal CYFIP2 antibody
CYFIP2 antibody
70R-13392 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal CYFIP2 antibody
CYFIP2 Antibody
36383-100ul 100ul
EUR 252
CYFIP2 Antibody
1-CSB-PA072935
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CYFIP2. Recognizes CYFIP2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200
CYFIP2 Antibody
1-CSB-PA122670
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CYFIP2. Recognizes CYFIP2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
CYFIP2 Antibody
1-CSB-PA951951
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CYFIP2. Recognizes CYFIP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000
CYFIP2 Antibody
DF12927 200ul
EUR 304
Description: CYFIP2 Antibody detects endogenous levels of CYFIP2.
CYFIP2 Antibody
1-CSB-PA006375GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CYFIP2. Recognizes CYFIP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
Anti-CYFIP2 Antibody
A06562 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYFIP2 Antibody (CYFIP2) detection.tested for IHC, WB in Human, Mouse, Rat.
CYFIP2 Conjugated Antibody
C36383 100ul
EUR 397
anti- CYFIP2 antibody
FNab02140 100µg
EUR 505.25
  • Immunogen: cytoplasmic FMR1 interacting protein 2
  • Uniprot ID: Q96F07
  • Gene ID: 26999
  • Research Area: Cell Division and Proliferation, Neuroscience, Immunology
Description: Antibody raised against CYFIP2
Anti-CYFIP2 antibody
PAab02140 100 ug
EUR 355
Anti-CYFIP2 antibody
STJ98613 200 µl
EUR 197
Description: Rabbit polyclonal to CYFIP2.
CYFIP2 siRNA
20-abx913330
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CYFIP2 siRNA
20-abx913331
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-CYFIP2
YF-PA26020 50 ul
EUR 334
Description: Mouse polyclonal to CYFIP2
CYFIP2 Blocking Peptide
DF12927-BP 1mg
EUR 195
CYFIP2 cloning plasmid
CSB-CL839319HU-10ug 10ug
EUR 1325
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3762
  • Sequence: atgaccacgcacgtcaccctggaagatgccctgtccaacgtggacctgcttgaagagcttcccctccccgaccagcagccatgcatcgagcctccaccttcctccatcatgtaccaggctaactttgacacaaactttgaggacaggaatgcatttgtcacgggcattgcaaggt
  • Show more
Description: A cloning plasmid for the CYFIP2 gene.
Anti-CYFIP2 (4G6)
YF-MA18141 100 ug
EUR 363
Description: Mouse monoclonal to CYFIP2
CYFIP2 ELISA KIT|Human
EF008955 96 Tests
EUR 689
Mouse CYFIP2 shRNA Plasmid
20-abx978710
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CYFIP2 shRNA Plasmid
20-abx958916
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rabbit Cytoplasmic FMR1 interacting protein 2(CYFIP2) ELISA kit
E04C2217-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cytoplasmic FMR1 interacting protein 2(CYFIP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Cytoplasmic FMR1 interacting protein 2(CYFIP2) ELISA kit
E04C2217-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cytoplasmic FMR1 interacting protein 2(CYFIP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Cytoplasmic FMR1 interacting protein 2(CYFIP2) ELISA kit
E04C2217-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cytoplasmic FMR1 interacting protein 2(CYFIP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Cytoplasmic FMR1-Interacting Protein 2 (CYFIP2) Antibody
20-abx003485
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Cytoplasmic FMR1-Interacting Protein 2 (CYFIP2) Antibody
20-abx213071
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Cytoplasmic FMR1-Interacting Protein 2 (CYFIP2) Antibody
20-abx213302
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Cytoplasmic FMR1-Interacting Protein 2 (CYFIP2) Antibody
20-abx111947
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Cytoplasmic FMR1-Interacting Protein 2 (CYFIP2) Antibody
abx122298-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Cytoplasmic FMR1-Interacting Protein 2 (CYFIP2) Antibody
20-abx329799
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Cytoplasmic FMR1-Interacting Protein 2 (CYFIP2) Antibody
abx232140-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Cyfip2 ORF Vector (Rat) (pORF)
ORF065670 1.0 ug DNA
EUR 506
CYFIP2 ORF Vector (Human) (pORF)
ORF002858 1.0 ug DNA
EUR 95
Cyfip2 ORF Vector (Mouse) (pORF)
ORF042338 1.0 ug DNA
EUR 506
Cyfip2 ORF Vector (Mouse) (pORF)
ORF042339 1.0 ug DNA
EUR 2402
Cyfip2 ORF Vector (Mouse) (pORF)
ORF042340 1.0 ug DNA
EUR 2422
CYFIP2 sgRNA CRISPR Lentivector set (Human)
K0548101 3 x 1.0 ug
EUR 339

CYFIP2 Rabbit Polyclonal Antibody