CREB3 Rabbit Polyclonal Antibody

CREB3 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

CREB3 Polyclonal Antibody
ABP57528-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from CREB3 at AA range: 151-200
  • Applications tips:
Description: A polyclonal antibody for detection of CREB3 from Human, Mouse, Rat. This CREB3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from CREB3 at AA range: 151-200

CREB3 Polyclonal Antibody
ES8521-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CREB3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CREB3 Polyclonal Antibody
ES8521-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CREB3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CREB3 Rabbit pAb
A13579-100ul 100 ul
EUR 308

CREB3 Rabbit pAb
A13579-200ul 200 ul
EUR 459

CREB3 Rabbit pAb
A13579-20ul 20 ul
EUR 183

CREB3 Rabbit pAb
A13579-50ul 50 ul
EUR 223

CREB3 Rabbit pAb
A6567-100ul 100 ul
EUR 308

CREB3 Rabbit pAb
A6567-200ul 200 ul
EUR 459

CREB3 Rabbit pAb
A6567-20ul 20 ul
EUR 183

CREB3 Rabbit pAb
A6567-50ul 50 ul
EUR 223

CREB3 antibody
70R-16581 50 ul
EUR 435
Description: Rabbit polyclonal CREB3 antibody

CREB3 antibody
39013-100ul 100ul
EUR 252

CREB3 antibody
10R-1626 100 ug
EUR 512
Description: Mouse monoclonal CREB3 antibody

CREB3 Antibody
1-CSB-PA005948ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
Description: A polyclonal antibody against CREB3. Recognizes CREB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:1000, IHC:1:20-200

CREB3 Antibody
1-CSB-PA005948GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CREB3. Recognizes CREB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal CREB3 Antibody (C-term)
APR11046G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CREB3 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal CREB3 Antibody (N-term)
AMM05358G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CREB3 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal CREB3 / LZIP Antibody (aa76-87)
APR11045G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CREB3 / LZIP (aa76-87). This antibody is tested and proven to work in the following applications:

Anti-CREB3 Antibody
A03564-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CREB3 Antibody (CREB3) detection. Tested with WB in Human, Mouse, Rat.

CREB3 Conjugated Antibody
C39013 100ul
EUR 397

anti- CREB3 antibody
FNab01962 100µg
EUR 505.25
  • Immunogen: cAMP responsive element binding protein 3
  • Uniprot ID: O43889
  • Gene ID: 10488
  • Research Area: Immunology, Metabolism
Description: Antibody raised against CREB3

Anti-CREB3 antibody
PAab01962 100 ug
EUR 355

Anti-CREB3 antibody
STJ28650 100 µl
EUR 277
Description: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds to the cAMP-response element and regulates cell proliferation. The protein interacts with host cell factor C1, which also associates with the herpes simplex virus (HSV) protein VP16 that induces transcription of HSV immediate-early genes. This protein and VP16 both bind to the same site on host cell factor C1. It is thought that the interaction between this protein and host cell factor C1 plays a role in the establishment of latency during HSV infection. This protein also plays a role in leukocyte migration, tumor suppression, and endoplasmic reticulum stress-associated protein degradation. Additional transcript variants have been identified, but their biological validity has not been determined.

Anti-CREB3 antibody
STJ115540 100 µl
EUR 277
Description: This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds to the cAMP-response element and regulates cell proliferation. The protein interacts with host cell factor C1, which also associates with the herpes simplex virus (HSV) protein VP16 that induces transcription of HSV immediate-early genes. This protein and VP16 both bind to the same site on host cell factor C1. It is thought that the interaction between this protein and host cell factor C1 plays a role in the establishment of latency during HSV infection. This protein also plays a role in leukocyte migration, tumor suppression, and endoplasmic reticulum stress-associated protein degradation. Additional transcript variants have been identified, but their biological validity has not been determined.

Anti-CREB3 antibody
STJ98634 200 µl
EUR 197
Description: Rabbit polyclonal to CREB3.

Polyclonal CREB3 (aa76-87) Antibody (internal region)
APR11044G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CREB3 (aa76-87) (internal region). This antibody is tested and proven to work in the following applications:

CREB3 siRNA
20-abx912771
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CREB3
YF-PA17002 100 ug
EUR 403
Description: Rabbit polyclonal to CREB3

anti-CREB3
YF-PA25589 50 ul
EUR 334
Description: Mouse polyclonal to CREB3

CREB3 cloning plasmid
CSB-CL005948HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1116
  • Sequence: atggagctggaattggatgctggtgaccaagacctgctggccttcctgctagaggaaagtggagatttggggacggcacccgatgaggccgtgagggccccactggactgggcgctgccgctttctgaggtaccgagcgactgggaagtagatgatttgctgtgctccctgctga
  • Show more
Description: A cloning plasmid for the CREB3 gene.

CREB3 cloning plasmid
CSB-CL005948HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1116
  • Sequence: atggagctggaattggatgctggtgaccaagacctgctggccttcctgctagaggaaagtggagatttggggacggcacccgatgaggccgtgagggccccactggactgggcgctgccgctttctgaggtaccgagcgactgggaagtagatgatttgctgtgctccctgctga
  • Show more
Description: A cloning plasmid for the CREB3 gene.

Anti-CREB3 (3H5)
YF-MA11292 100 ug
EUR 363
Description: Mouse monoclonal to CREB3

Anti-CREB3 (aa76-87) antibody
STJ73025 100 µg
EUR 359

Bovine CREB3 ELISA KIT
ELI-10455b 96 Tests
EUR 928

Mouse Creb3 ELISA KIT
ELI-26119m 96 Tests
EUR 865

CREB3 ELISA KIT|Human
EF008836 96 Tests
EUR 689

Human CREB3 shRNA Plasmid
20-abx957125
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CREB3 ELISA KIT
ELI-50475h 96 Tests
EUR 824

CREB3 Recombinant Protein (Human)
RP007975 100 ug Ask for price

CREB3 Recombinant Protein (Human)
RP007978 100 ug Ask for price

CREB3 Recombinant Protein (Rat)
RP196241 100 ug Ask for price

CREB3 Recombinant Protein (Mouse)
RP125930 100 ug Ask for price

Monoclonal CREB3 Antibody (monoclonal) (M01), Clone: 3H5
AMM05357G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CREB3 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3H5. This antibody is applicable in WB and IHC, E

Creb3 ORF Vector (Rat) (pORF)
ORF065415 1.0 ug DNA
EUR 506

CREB3 ORF Vector (Human) (pORF)
ORF002659 1.0 ug DNA
EUR 95

CREB3 ORF Vector (Human) (pORF)
ORF002660 1.0 ug DNA
EUR 95

Creb3 ORF Vector (Mouse) (pORF)
ORF041978 1.0 ug DNA
EUR 506

Rabbit Cyclic AMP responsive element binding protein 3(CREB3) ELISA kit
E04C2043-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cyclic AMP responsive element binding protein 3(CREB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cyclic AMP responsive element binding protein 3(CREB3) ELISA kit
E04C2043-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cyclic AMP responsive element binding protein 3(CREB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cyclic AMP responsive element binding protein 3(CREB3) ELISA kit
E04C2043-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cyclic AMP responsive element binding protein 3(CREB3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CREB3 sgRNA CRISPR Lentivector set (Human)
K0505301 3 x 1.0 ug
EUR 339

Creb3 sgRNA CRISPR Lentivector set (Rat)
K6338501 3 x 1.0 ug
EUR 339

Creb3 sgRNA CRISPR Lentivector set (Mouse)
K3950901 3 x 1.0 ug
EUR 339

Cyclic AMP-Responsive Element Binding Protein 3 (CREB3) Antibody
20-abx005039
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cyclic AMP-Responsive Element Binding Protein 3 (CREB3) Antibody
20-abx111343
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cyclic AMP-Responsive Element Binding Protein 3 (CREB3) Antibody
abx145042-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Cyclic AMP-Responsive Element Binding Protein 3 (CREB3) Antibody
abx031346-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Cyclic AMP-Responsive Element Binding Protein 3 (CREB3) Antibody
abx031346-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Cyclic AMP-Responsive Element Binding Protein 3 (CREB3) Antibody
20-abx321523
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cyclic AMP-Responsive Element Binding Protein 3 (CREB3) Antibody
abx432549-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Cyclic AMP-Responsive Element Binding Protein 3 (CREB3) Antibody
abx231962-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CREB3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0505302 1.0 ug DNA
EUR 154

CREB3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0505303 1.0 ug DNA
EUR 154

CREB3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0505304 1.0 ug DNA
EUR 154

Creb3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6338502 1.0 ug DNA
EUR 154

Creb3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6338503 1.0 ug DNA
EUR 154

CREB3 Rabbit Polyclonal Antibody