CD72 Rabbit Polyclonal Antibody

CD72 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

CD72 Polyclonal Antibody
ES8388-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD72 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
CD72 Polyclonal Antibody
ES8388-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD72 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
CD72 Polyclonal Antibody
ABP57395-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD72
  • Applications tips:
Description: A polyclonal antibody for detection of CD72 from Human. This CD72 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD72
CD72 Polyclonal Antibody
ABP57395-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD72
  • Applications tips:
Description: A polyclonal antibody for detection of CD72 from Human. This CD72 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD72
CD72 Polyclonal Antibody
ABP57395-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD72
  • Applications tips:
Description: A polyclonal antibody for detection of CD72 from Human. This CD72 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD72
CD72 Rabbit pAb
A9930-100ul 100 ul
EUR 308
CD72 Rabbit pAb
A9930-200ul 200 ul
EUR 459
CD72 Rabbit pAb
A9930-20ul 20 ul
EUR 183
CD72 Rabbit pAb
A9930-50ul 50 ul
EUR 223
Human Cluster Of Differentiation 72 (CD72) ELISA Kit
DLR-CD72-Hu-48T 48T
EUR 498
  • Should the Human Cluster Of Differentiation 72 (CD72) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cluster Of Differentiation 72 (CD72) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Cluster Of Differentiation 72 (CD72) ELISA Kit
DLR-CD72-Hu-96T 96T
EUR 647
  • Should the Human Cluster Of Differentiation 72 (CD72) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cluster Of Differentiation 72 (CD72) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Cluster Of Differentiation 72 (CD72) ELISA Kit
RD-CD72-Hu-48Tests 48 Tests
EUR 500
Human Cluster Of Differentiation 72 (CD72) ELISA Kit
RD-CD72-Hu-96Tests 96 Tests
EUR 692
Human Cluster Of Differentiation 72 (CD72) ELISA Kit
RDR-CD72-Hu-48Tests 48 Tests
EUR 522
Human Cluster Of Differentiation 72 (CD72) ELISA Kit
RDR-CD72-Hu-96Tests 96 Tests
EUR 724
CD72 antibody
70R-CR046 100 ug
EUR 300
Description: Affinity purified Rabbit polyclonal CD72 antibody
CD72 antibody
70R-CR047 100 ug
EUR 300
Description: Affinity purified Rabbit polyclonal CD72 antibody
CD72 Antibody
ABD7910 100 ug
EUR 438
CD72 Antibody
45176-100ul 100ul
EUR 252
CD72 Antibody
45176-50ul 50ul
EUR 187
CD72 antibody
70R-16286 50 ul
EUR 435
Description: Rabbit polyclonal CD72 antibody
CD72 Antibody
DF7910 200ul
EUR 304
Description: CD72 Antibody detects endogenous levels of total CD72.
CD72 Antibody
1-CSB-PA004955GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CD72. Recognizes CD72 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB
CD72 Antibody
1-CSB-PA004955LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD72. Recognizes CD72 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200
CD72 Antibody
1-CSB-PA215043
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CD72. Recognizes CD72 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
Rabbit B cell differentiation antigen CD72(CD72) ELISA kit
E04B0881-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit B cell differentiation antigen CD72(CD72) ELISA kit
E04B0881-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit B cell differentiation antigen CD72(CD72) ELISA kit
E04B0881-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
anti- CD72 antibody
FNab01498 100µg
EUR 505.25
  • Immunogen: CD72 molecule
  • Uniprot ID: P21854
  • Gene ID: 971
  • Research Area: Immunology, Cardiovascular
Description: Antibody raised against CD72
Anti-CD72 Antibody
A09292-1 100ug/vial
EUR 294
Anti-CD72 antibody
PAab01498 100 ug
EUR 355
Anti-CD72 antibody
STJ97662 200 µl
EUR 197
Description: Rabbit polyclonal to CD72.
Anti-CD72 antibody
STJ111971 100 µl
EUR 277
CD72 Protein
20-abx263522
  • EUR 829.00
  • EUR 411.00
  • EUR 537.00
  • 10 ug
  • 2 µg
  • 5 ug
  • Shipped within 5-10 working days.
CD72 siRNA
20-abx911067
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CD72 siRNA
20-abx911068
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CD72 Antibody, HRP conjugated
1-CSB-PA004955LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD72. Recognizes CD72 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
CD72 Antibody, FITC conjugated
1-CSB-PA004955LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD72. Recognizes CD72 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
CD72 Antibody, Biotin conjugated
1-CSB-PA004955LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD72. Recognizes CD72 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Human)
4-PAB261Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Glu169~Asp359)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cluster Of Differentiation 72 (CD72)
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse)
4-PAB261Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Leu143~Phe345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 72 (CD72)
CD72 cloning plasmid
CSB-CL004955HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1080
  • Sequence: atggctgaggccatcacctatgcagatctgaggtttgtgaaggctcccctgaagaagagcatctccagccggttaggacaggacccaggggctgatgatgatggggaaatcacctacgagaatgttcaagtgcccgcagtcctaggggtgccctcaagcttggcttcttctgtac
  • Show more
Description: A cloning plasmid for the CD72 gene.
CD72 Blocking Peptide
20-abx161329
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
Recombinant Human CD72
7-04738 2µg Ask for price
Recombinant Human CD72
7-04739 5µg Ask for price
Recombinant Human CD72
7-04740 10µg Ask for price
CD72 Blocking Peptide
DF7910-BP 1mg
EUR 195
Anti-CD72 (4D10)
YF-MA20291 100 ug
EUR 363
Description: Mouse monoclonal to CD72
Monoclonal CD72 Antibody, Clone: EPR3571
APR15354G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human CD72. The antibodies are raised in Rabbit and are from clone EPR3571. This antibody is applicable in WB
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Human), APC
4-PAB261Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Glu169~Asp359)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cluster Of Differentiation 72 (CD72). This antibody is labeled with APC.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Human), Biotinylated
4-PAB261Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Glu169~Asp359)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cluster Of Differentiation 72 (CD72). This antibody is labeled with Biotin.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Human), Cy3
4-PAB261Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Glu169~Asp359)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cluster Of Differentiation 72 (CD72). This antibody is labeled with Cy3.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Human), FITC
4-PAB261Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Glu169~Asp359)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cluster Of Differentiation 72 (CD72). This antibody is labeled with FITC.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Human), HRP
4-PAB261Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Glu169~Asp359)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cluster Of Differentiation 72 (CD72). This antibody is labeled with HRP.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Human), PE
4-PAB261Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Glu169~Asp359)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cluster Of Differentiation 72 (CD72). This antibody is labeled with PE.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse), APC
4-PAB261Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Leu143~Phe345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 72 (CD72). This antibody is labeled with APC.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse), Biotinylated
4-PAB261Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Leu143~Phe345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 72 (CD72). This antibody is labeled with Biotin.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse), Cy3
4-PAB261Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Leu143~Phe345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 72 (CD72). This antibody is labeled with Cy3.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse), FITC
4-PAB261Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Leu143~Phe345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 72 (CD72). This antibody is labeled with FITC.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse), HRP
4-PAB261Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Leu143~Phe345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 72 (CD72). This antibody is labeled with HRP.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse), PE
4-PAB261Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Leu143~Phe345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 72 (CD72). This antibody is labeled with PE.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse, Rat)
4-PAB261Ra01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Val126~His237)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Cluster Of Differentiation 72 (CD72)
Goat B cell differentiation antigen CD72(CD72) ELISA kit
E06B0881-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat B cell differentiation antigen CD72(CD72) ELISA kit
E06B0881-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat B cell differentiation antigen CD72(CD72) ELISA kit
E06B0881-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat B cell differentiation antigen CD72(CD72) ELISA kit
E02B0881-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat B cell differentiation antigen CD72(CD72) ELISA kit
E02B0881-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat B cell differentiation antigen CD72(CD72) ELISA kit
E02B0881-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human B cell differentiation antigen CD72(CD72) ELISA kit
E01B0881-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human B cell differentiation antigen CD72(CD72) ELISA kit
E01B0881-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human B cell differentiation antigen CD72(CD72) ELISA kit
E01B0881-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse B cell differentiation antigen CD72(CD72) ELISA kit
E03B0881-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse B cell differentiation antigen CD72(CD72) ELISA kit
E03B0881-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse B cell differentiation antigen CD72(CD72) ELISA kit
E03B0881-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig B cell differentiation antigen CD72(CD72) ELISA kit
E07B0881-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig B cell differentiation antigen CD72(CD72) ELISA kit
E07B0881-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig B cell differentiation antigen CD72(CD72) ELISA kit
E07B0881-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey B cell differentiation antigen CD72(CD72) ELISA kit
E09B0881-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey B cell differentiation antigen CD72(CD72) ELISA kit
E09B0881-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey B cell differentiation antigen CD72(CD72) ELISA kit
E09B0881-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog B cell differentiation antigen CD72(CD72) ELISA kit
E08B0881-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog B cell differentiation antigen CD72(CD72) ELISA kit
E08B0881-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog B cell differentiation antigen CD72(CD72) ELISA kit
E08B0881-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human B- cell differentiation antigen CD72, CD72 ELISA KIT
ELI-10551h 96 Tests
EUR 824
Mouse B- cell differentiation antigen CD72, Cd72 ELISA KIT
ELI-25432m 96 Tests
EUR 865
Human B-Cell Differentiation Antigen CD72 (CD72) ELISA Kit
20-abx151005
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human B-Cell Differentiation Antigen CD72 (CD72) ELISA Kit
abx257696-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Human B-cell differentiation antigen CD72(CD72) ELISA kit
CSB-EL004955HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human B-cell differentiation antigen CD72 (CD72) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human B-cell differentiation antigen CD72(CD72) ELISA kit
1-CSB-EL004955HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human B-cell differentiation antigen CD72(CD72) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Human), APC-Cy7
4-PAB261Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Glu169~Asp359)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cluster Of Differentiation 72 (CD72). This antibody is labeled with APC-Cy7.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB261Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Leu143~Phe345)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 72 (CD72). This antibody is labeled with APC-Cy7.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse, Rat), APC
4-PAB261Ra01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Val126~His237)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Cluster Of Differentiation 72 (CD72). This antibody is labeled with APC.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAB261Ra01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Val126~His237)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Cluster Of Differentiation 72 (CD72). This antibody is labeled with Biotin.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAB261Ra01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Val126~His237)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Cluster Of Differentiation 72 (CD72). This antibody is labeled with Cy3.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse, Rat), FITC
4-PAB261Ra01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Val126~His237)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Cluster Of Differentiation 72 (CD72). This antibody is labeled with FITC.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse, Rat), HRP
4-PAB261Ra01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Val126~His237)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Cluster Of Differentiation 72 (CD72). This antibody is labeled with HRP.
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse, Rat), PE
4-PAB261Ra01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Val126~His237)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Cluster Of Differentiation 72 (CD72). This antibody is labeled with PE.
Guinea pig B cell differentiation antigen CD72(CD72) ELISA kit
E05B0881-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig B cell differentiation antigen CD72(CD72) ELISA kit
E05B0881-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig B cell differentiation antigen CD72(CD72) ELISA kit
E05B0881-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig B cell differentiation antigen CD72(CD72) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Anti Human Cd72 Monoclonal Antibody
CABT-52293MH 0.2 mg
EUR 741
Cluster of Differentiation 72 (CD72) Antibody
20-abx111493
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Cluster of Differentiation 72 (CD72) Antibody
20-abx129667
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Cluster of Differentiation 72 (CD72) Antibody
20-abx121329
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Cluster of Differentiation 72 (CD72) Antibody
abx139327-01mg 0.1 mg
EUR 356
  • Shipped within 5-12 working days.
Cluster of Differentiation 72 (CD72) Antibody
20-abx149099
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Cluster of Differentiation 72 (CD72) Antibody
20-abx135850
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Cluster of Differentiation 72 (CD72) Antibody
20-abx102985
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Cluster of Differentiation 72 (CD72) Antibody
20-abx102986
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Cluster of Differentiation 72 (CD72) Antibody
20-abx323362
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Cluster of Differentiation 72 (CD72) Antibody
20-abx270087
  • EUR 467.00
  • EUR 537.00
  • EUR 272.00
  • EUR 815.00
  • EUR 356.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-12 working days.
Cluster of Differentiation 72 (CD72) Antibody
abx231498-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Cluster Of Differentiation 72 (CD72) Antibody
20-abx171796
  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.
CD72 ELISA KIT|Human
EF007366 96 Tests
EUR 689
Human CD72 shRNA Plasmid
20-abx950692
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-Hu CD72 Purified
11-310-C025 0.025 mg
EUR 99
Anti-Hu CD72 Purified
11-310-C100 0.1 mg
EUR 158
Anti-Hu CD72 PE
1P-310-T025 25 tests
EUR 140
Anti-Hu CD72 PE
1P-310-T100 100 tests
EUR 240
Mouse CD72 shRNA Plasmid
20-abx969580
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CD72 Human Recombinant Protein
PROTP21854 Regular: 5ug
EUR 479
Description: CD72 Human Recombinant (aa 1-98) expressed in E.coli, shows a 38 kDa band on SDS-PAGE. ;The CD72 is purified by proprietary chromatographic techniques.
Recombinant (E.Coli) Human CD72
RP-926 2 ug
EUR 347
CD72 Recombinant Protein (Human)
RP006412 100 ug Ask for price
pCMV-SPORT6-CD72 Plasmid
PVT16548 2 ug
EUR 325
CD72 Recombinant Protein (Rat)
RP194021 100 ug Ask for price
CD72 Recombinant Protein (Mouse)
RP122684 100 ug Ask for price
CD72 Recombinant Protein (Mouse)
RP122687 100 ug Ask for price
CD72 Recombinant Protein (Mouse)
RP122690 100 ug Ask for price
CD72 Recombinant Protein (Mouse)
RP122693 100 ug Ask for price
Cluster Of Differentiation 72 (CD72) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAB261Ra01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD72 (Val126~His237)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Cluster Of Differentiation 72 (CD72). This antibody is labeled with APC-Cy7.
Cluster of Differentiation 72 (CD72) Antibody (PE)
abx139328-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.
Cluster of Differentiation 72 (CD72) Antibody (FITC)
20-abx270385
  • EUR 523.00
  • EUR 606.00
  • EUR 300.00
  • EUR 940.00
  • EUR 384.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.
Cluster of Differentiation 72 (CD72) Antibody (APC)
20-abx270617
  • EUR 704.00
  • EUR 829.00
  • EUR 370.00
  • EUR 1330.00
  • EUR 495.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.
Cluster of Differentiation 72 (CD72) Antibody (PE)
20-abx270849
  • EUR 606.00
  • EUR 718.00
  • EUR 328.00
  • EUR 1135.00
  • EUR 439.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.
Anti-Hu CD72 Alexa Fluor488
A4-310-T025 25 tests
EUR 154
CD72 ORF Vector (Human) (pORF)
ORF002138 1.0 ug DNA
EUR 95
Cd72 ORF Vector (Mouse) (pORF)
ORF040896 1.0 ug DNA
EUR 506
Cd72 ORF Vector (Mouse) (pORF)
ORF040897 1.0 ug DNA
EUR 506
Cd72 ORF Vector (Mouse) (pORF)
ORF040898 1.0 ug DNA
EUR 506
Cd72 ORF Vector (Mouse) (pORF)
ORF040899 1.0 ug DNA
EUR 506
Cd72 ORF Vector (Rat) (pORF)
ORF064675 1.0 ug DNA
EUR 506
CD72 ELISA Kit (Human) (OKCD00273)
OKCD00273 96 Wells
EUR 792
Description: Description of target: Plays a role in B-cell proliferation and differentiation. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL
Anti-CD72 (10D6.8.1)-SPP-DM1 ADC
ADC-W-609 1mg Ask for price
Description: This ADC product is comprised of an anti-CD72 monoclonal antibody (10D6
Anti-CD72 (10D6.8.1)-MCC-DM1 ADC
ADC-W-610 1mg Ask for price
Description: This ADC product is comprised of an anti-CD72 monoclonal antibody (10D6
Anti-CD72 (10D6.8.1)-Mc-MMAF ADC
ADC-W-612 1mg Ask for price
Description: This ADC product is comprised of an anti-CD72 monoclonal antibody (10D6
CD72 sgRNA CRISPR Lentivector set (Human)
K0403701 3 x 1.0 ug
EUR 339
Cd72 sgRNA CRISPR Lentivector set (Mouse)
K3361201 3 x 1.0 ug
EUR 339
Cd72 sgRNA CRISPR Lentivector set (Rat)
K7224701 3 x 1.0 ug
EUR 339
Recombinant Cluster Of Differentiation 72 (CD72)
4-RPB261Hu01
  • EUR 483.49
  • EUR 232.00
  • EUR 1538.08
  • EUR 579.36
  • EUR 1058.72
  • EUR 386.00
  • EUR 3695.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P21854
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.6kDa
  • Isoelectric Point: 8.6
Description: Recombinant Human Cluster Of Differentiation 72 expressed in: E.coli
Recombinant Cluster Of Differentiation 72 (CD72)
4-RPB261Mu01
  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P21855
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.9kDa
  • Isoelectric Point: 7.6
Description: Recombinant Mouse Cluster Of Differentiation 72 expressed in: E.coli
Recombinant Cluster Of Differentiation 72 (CD72)
4-RPB261Ra01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q5BK59
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.2kDa
  • Isoelectric Point: 8.8
Description: Recombinant Rat Cluster Of Differentiation 72 expressed in: E.coli
CD72 sgRNA CRISPR Lentivector (Human) (Target 1)
K0403702 1.0 ug DNA
EUR 154
CD72 sgRNA CRISPR Lentivector (Human) (Target 2)
K0403703 1.0 ug DNA
EUR 154
CD72 sgRNA CRISPR Lentivector (Human) (Target 3)
K0403704 1.0 ug DNA
EUR 154
Human Cluster Of Differentiation 72 (CD72) Protein
20-abx065939
  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Rat Cluster Of Differentiation 72 (CD72) Protein
20-abx065940
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Cluster Of Differentiation 72 (CD72) Protein
20-abx167294
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Cd72 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3361202 1.0 ug DNA
EUR 154
Cd72 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3361203 1.0 ug DNA
EUR 154
Cd72 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3361204 1.0 ug DNA
EUR 154
Cd72 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7224702 1.0 ug DNA
EUR 154
Cd72 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7224703 1.0 ug DNA
EUR 154
Cd72 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7224704 1.0 ug DNA
EUR 154
Recombinant Human CD72 Protein, Untagged, E.coli-10ug
QP11345-10ug 10ug
EUR 553
Recombinant Human CD72 Protein, Untagged, E.coli-2ug
QP11345-2ug 2ug
EUR 245
Recombinant Human CD72 Protein, Untagged, E.coli-5ug
QP11345-5ug 5ug
EUR 336
CD72 Protein Vector (Human) (pPB-C-His)
PV008549 500 ng
EUR 329
CD72 Protein Vector (Human) (pPB-N-His)
PV008550 500 ng
EUR 329

CD72 Rabbit Polyclonal Antibody