CASR Rabbit Polyclonal Antibody

CASR Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

CASR Polyclonal Antibody
ABP57220-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CASR from Mouse, Rat. This CASR antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

CASR Polyclonal Antibody
ABP57220-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CASR from Mouse, Rat. This CASR antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

CaSR Polyclonal Antibody
ABP56765-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human CaSR around the non-phosphorylation site of T888
  • Applications tips:
Description: A polyclonal antibody for detection of CaSR from Human, Mouse, Rat. This CaSR antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CaSR around the non-phosphorylation site of T888

CaSR Polyclonal Antibody
ABP56765-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human CaSR around the non-phosphorylation site of T888
  • Applications tips:
Description: A polyclonal antibody for detection of CaSR from Human, Mouse, Rat. This CaSR antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CaSR around the non-phosphorylation site of T888

CaSR Polyclonal Antibody
ABP56765-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human CaSR around the non-phosphorylation site of T888
  • Applications tips:
Description: A polyclonal antibody for detection of CaSR from Human, Mouse, Rat. This CaSR antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CaSR around the non-phosphorylation site of T888

CaSR Polyclonal Antibody
ES7764-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CaSR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CaSR Polyclonal Antibody
ES7764-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CaSR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CASR Polyclonal Antibody
ES8219-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CASR from Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

CASR Polyclonal Antibody
ES8219-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CASR from Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

Mouse Calcium Sensing Receptor (CASR) ELISA Kit
DLR-CASR-Mu-48T 48T
EUR 527
  • Should the Mouse Calcium Sensing Receptor (CASR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Calcium Sensing Receptor (CASR) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Calcium Sensing Receptor (CASR) ELISA Kit
DLR-CASR-Mu-96T 96T
EUR 688
  • Should the Mouse Calcium Sensing Receptor (CASR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Calcium Sensing Receptor (CASR) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Calcium Sensing Receptor (CASR) ELISA Kit
RDR-CASR-Mu-48Tests 48 Tests
EUR 557

Mouse Calcium Sensing Receptor (CASR) ELISA Kit
RDR-CASR-Mu-96Tests 96 Tests
EUR 774

Mouse Calcium Sensing Receptor (CASR) ELISA Kit
RD-CASR-Mu-48Tests 48 Tests
EUR 533

Mouse Calcium Sensing Receptor (CASR) ELISA Kit
RD-CASR-Mu-96Tests 96 Tests
EUR 740

CASR Rabbit pAb
A13000-100ul 100 ul
EUR 308

CASR Rabbit pAb
A13000-200ul 200 ul
EUR 459

CASR Rabbit pAb
A13000-20ul 20 ul
EUR 183

CASR Rabbit pAb
A13000-50ul 50 ul
EUR 223

CASR Rabbit pAb
A1426-100ul 100 ul
EUR 308

CASR Rabbit pAb
A1426-200ul 200 ul
EUR 459

CASR Rabbit pAb
A1426-20ul 20 ul
EUR 183

CASR Rabbit pAb
A1426-50ul 50 ul
EUR 223

Rabbit CaSR ELISA Kit
ERTC0544 96Tests
EUR 521

CASR Polyclonal Antibody, Biotin Conjugated
A53021 100 µg
EUR 570.55
Description: kits suitable for this type of research

CASR Polyclonal Antibody, FITC Conjugated
A53022 100 µg
EUR 570.55
Description: fast delivery possible

CASR Polyclonal Antibody, HRP Conjugated
A53023 100 µg
EUR 570.55
Description: reagents widely cited

CaSR (phospho Thr888) Polyclonal Antibody
ABP56764-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human CaSR around the phosphorylation site of T888
  • Applications tips:
Description: A polyclonal antibody for detection of CaSR phospho Thr888) from Human, Mouse, Rat. This CaSR phospho Thr888) antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CaSR around the phosphorylation site of T888

CaSR (phospho Thr888) Polyclonal Antibody
ABP56764-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human CaSR around the phosphorylation site of T888
  • Applications tips:
Description: A polyclonal antibody for detection of CaSR phospho Thr888) from Human, Mouse, Rat. This CaSR phospho Thr888) antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CaSR around the phosphorylation site of T888

CaSR (phospho Thr888) Polyclonal Antibody
ABP56764-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human CaSR around the phosphorylation site of T888
  • Applications tips:
Description: A polyclonal antibody for detection of CaSR phospho Thr888) from Human, Mouse, Rat. This CaSR phospho Thr888) antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CaSR around the phosphorylation site of T888

CaSR (phospho Thr888) Polyclonal Antibody
ES7763-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CaSR (phospho Thr888) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

CaSR (phospho Thr888) Polyclonal Antibody
ES7763-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CaSR (phospho Thr888) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

CASR antibody
70R-16185 50 ul
EUR 435
Description: Rabbit polyclonal CASR antibody

CASR Antibody
46408-100ul 100ul
EUR 252

CASR Antibody
1-CSB-PA004558EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CASR. Recognizes CASR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

CASR Antibody
1-CSB-PA004558GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CASR. Recognizes CASR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CASR Antibody
1-CSB-PA070031
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CASR. Recognizes CASR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

CASR Antibody
1-CSB-PA080191
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against CASR. Recognizes CASR from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:500-1000.IHC:1:200-500

CASR Antibody
CSB-PA443839-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Store at -20°C.Stable for 12 months from date of receipt. Antigen Affinity Purified
Description: A polyclonal antibody against CASR. Recognizes CASR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CASR Antibody
CSB-PA443839-100ul 100ul
EUR 314
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline , pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Store at -20°C.Stable for 12 months from date of receipt. Antigen Affinity Purified
Description: A polyclonal antibody against CASR. Recognizes CASR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CASR antibody
70R-33449 100 ug
EUR 327
Description: Rabbit polyclonal CASR antibody

CASR antibody (Thr888)
70R-33448 100 ug
EUR 327
Description: Rabbit polyclonal CASR antibody (Thr888)

CASR Conjugated Antibody
C46408 100ul
EUR 397

CASR (pT888) Antibody
abx333456-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Anti-CASR antibody
STJ114969 100 µl
EUR 277
Description: The protein encoded by this gene is a G protein-coupled receptor that is expressed in the parathyroid hormone (PTH)-producing chief cells of the parathyroid gland, and the cells lining the kidney tubule. It senses small changes in circulating calcium concentration and couples this information to intracellular signaling pathways that modify PTH secretion or renal cation handling, thus this protein plays an essential role in maintaining mineral ion homeostasis. Mutations in this gene cause familial hypocalciuric hypercalcemia, familial, isolated hypoparathyroidism, and neonatal severe primary hyperparathyroidism.

Anti-CaSR antibody
STJ92031 200 µl
EUR 197
Description: Rabbit polyclonal to CaSR.

Anti-CASR Antibody
STJ500366 100 µg
EUR 476

Anti-CASR antibody
STJ22909 100 µl
EUR 277
Description: The protein encoded by this gene is a G protein-coupled receptor that is expressed in the parathyroid hormone (PTH)-producing chief cells of the parathyroid gland, and the cells lining the kidney tubule. It senses small changes in circulating calcium concentration and couples this information to intracellular signaling pathways that modify PTH secretion or renal cation handling, thus this protein plays an essential role in maintaining mineral ion homeostasis. Mutations in this gene cause familial hypocalciuric hypercalcemia, familial, isolated hypoparathyroidism, and neonatal severe primary hyperparathyroidism.

Anti-CASR antibody
STJ97414 200 µl
EUR 197
Description: Rabbit polyclonal to CASR.

Casr/ Rat Casr ELISA Kit
ELI-04986r 96 Tests
EUR 886

Calcium Sensing Receptor (CASR) Polyclonal Antibody (Mouse)
4-PAC414Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CASR (Lys863~Ser1079)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Sensing Receptor (CASR)

CASR siRNA
20-abx900805
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CASR siRNA
20-abx910356
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CASR siRNA
20-abx910357
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CASR Antibody, HRP conjugated
1-CSB-PA004558EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CASR. Recognizes CASR from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CASR Antibody, FITC conjugated
1-CSB-PA004558EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CASR. Recognizes CASR from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CASR Antibody, Biotin conjugated
1-CSB-PA004558ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CASR. Recognizes CASR from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-CASR (T888) Antibody
1-CSB-PA070030
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-CASR (T888). Recognizes Phospho-CASR (T888) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/40000

Phospho-CASR (Thr888) Antibody
CSB-PA446768-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-CASR (Thr888). Recognizes Phospho-CASR (Thr888) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-CASR (Thr888) Antibody
CSB-PA446768-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-CASR (Thr888). Recognizes Phospho-CASR (Thr888) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Anti-CASR Antibody (Biotin)
STJ500367 100 µg
EUR 586

Anti-CASR Antibody (FITC)
STJ500368 100 µg
EUR 586

Polyclonal CASR/Calcium Sensing Receptor Antibody (N-Terminus)
APG02424G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CASR/Calcium Sensing Receptor (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal CASR/Calcium Sensing Receptor Antibody (N-Terminus)
APG02425G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CASR/Calcium Sensing Receptor (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal CASR/Calcium Sensing Receptor Antibody (N-Terminus)
APG02426G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CASR/Calcium Sensing Receptor (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal CASR/Calcium Sensing Receptor Antibody (N-Terminus)
APG02427G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CASR/Calcium Sensing Receptor (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal CASR/Calcium Sensing Receptor Antibody (N-Terminus)
APG02428G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CASR/Calcium Sensing Receptor (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal CASR/Calcium Sensing Receptor Antibody (N-Terminus)
APG02429G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CASR/Calcium Sensing Receptor (N-Terminus). This antibody is tested and proven to work in the following applications:

Calcium Sensing Receptor (CASR) Polyclonal Antibody (Mouse), APC
4-PAC414Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CASR (Lys863~Ser1079)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Sensing Receptor (CASR). This antibody is labeled with APC.

Calcium Sensing Receptor (CASR) Polyclonal Antibody (Mouse), Biotinylated
4-PAC414Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CASR (Lys863~Ser1079)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Sensing Receptor (CASR). This antibody is labeled with Biotin.

Calcium Sensing Receptor (CASR) Polyclonal Antibody (Mouse), Cy3
4-PAC414Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CASR (Lys863~Ser1079)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Sensing Receptor (CASR). This antibody is labeled with Cy3.

Calcium Sensing Receptor (CASR) Polyclonal Antibody (Mouse), FITC
4-PAC414Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CASR (Lys863~Ser1079)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Sensing Receptor (CASR). This antibody is labeled with FITC.

Calcium Sensing Receptor (CASR) Polyclonal Antibody (Mouse), HRP
4-PAC414Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CASR (Lys863~Ser1079)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Sensing Receptor (CASR). This antibody is labeled with HRP.

Calcium Sensing Receptor (CASR) Polyclonal Antibody (Mouse), PE
4-PAC414Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CASR (Lys863~Ser1079)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Sensing Receptor (CASR). This antibody is labeled with PE.

Rabbit Calcium Sensing Receptor (CaSR) ELISA Kit
abx362762-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

CASR cloning plasmid
CSB-CL004558HU-10ug 10ug
EUR 1189
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3237
  • Sequence: ATGGCATTTTATAGCTGCTGCTGGGTCCTCTTGGCACTCACCTGGCACACCTCTGCCTACGGGCCAGACCAGCGAGCCCAAAAGAAGGGGGACATTATCCTTGGGGGGCTCTTTCCTATTCATTTTGGAGTAGCAGCTAAAGATCAAGATCTCAAATCAAGGCCGGAGTCTGTGG
  • Show more
Description: A cloning plasmid for the CASR gene.

HEK-CaSR cells
S0014002 One Frozen vial
EUR 1011

Calcium Sensing Receptor (CASR) Antibody
20-abx175670
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Calcium Sensing Receptor (CASR) Antibody
20-abx111317
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calcium Sensing Receptor (CASR) Antibody
20-abx129478
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calcium Sensing Receptor (CASR) Antibody
20-abx134184
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Calcium Sensing Receptor (CASR) Antibody
20-abx109770
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcium Sensing Receptor (CASR) Antibody
abx011634-100ug 100 ug
EUR 425
  • Shipped within 5-10 working days.

Calcium Sensing Receptor (CASR) Antibody
abx031413-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Calcium Sensing Receptor (CASR) Antibody
abx031413-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Calcium Sensing Receptor (CASR) Antibody
20-abx328944
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcium Sensing Receptor (CASR) Antibody
20-abx330239
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcium Sensing Receptor (CASR) Antibody
abx332228-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Calcium Sensing Receptor (CASR) Antibody
abx448559-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

Calcium Sensing Receptor (CASR) Antibody
abx231194-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Calcium Sensing Receptor (CASR) Antibody
20-abx001232
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-CASR Antibody (monoclonal, 11E9)
M00574 100ug/vial
EUR 334

Anti-Phospho-CaSR (T888) antibody
STJ90701 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-CaSR (T888).

Calcium Sensing Receptor (CASR) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC414Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CASR (Lys863~Ser1079)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Sensing Receptor (CASR). This antibody is labeled with APC-Cy7.

Rabbit Extracellular calcium sensing receptor(CASR) ELISA kit
E04E0366-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Extracellular calcium sensing receptor(CASR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Extracellular calcium sensing receptor(CASR) ELISA kit
E04E0366-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Extracellular calcium sensing receptor(CASR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Extracellular calcium sensing receptor(CASR) ELISA kit
E04E0366-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Extracellular calcium sensing receptor(CASR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Calcium Sensing Receptor (CASR) Antibody (Biotin)
20-abx105398
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcium Sensing Receptor (CASR) Antibody (FITC)
20-abx106817
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcium Sensing Receptor (CASR) Antibody (HRP)
20-abx108236
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcium Sensing Receptor (CASR) Antibody (ALP)
abx445336-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Calcium Sensing Receptor (CASR) Antibody (APC)
abx445337-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Calcium Sensing Receptor (CASR) Antibody (PerCP)
abx445342-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Calcium Sensing Receptor (CASR) Antibody (RPE)
abx445343-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Calcium Sensing Receptor (CASR) Antibody (Streptavidin)
abx445344-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Anti-Calcium Sensing Receptor/CASR Antibody
PB9924 100ug/vial
EUR 334

Human CaSR ELISA Kit
EHC0544 96Tests
EUR 521

Human CASR ELISA Kit
ELA-E1510h 96 Tests
EUR 824

Goat CaSR ELISA Kit
EGTC0544 96Tests
EUR 521

Bovine CaSR ELISA Kit
EBC0544 96Tests
EUR 521

Canine CaSR ELISA Kit
ECC0544 96Tests
EUR 521

Anserini CaSR ELISA Kit
EAC0544 96Tests
EUR 521

CASR ELISA KIT|Human
EF006918 96 Tests
EUR 689

Rat CASR shRNA Plasmid
20-abx984401
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CASR shRNA Plasmid
20-abx969490
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CASR shRNA Plasmid
20-abx950600
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CaSR ELISA Kit
EMC0544 96Tests
EUR 521

Rat CaSR ELISA Kit
ERC0544 96Tests
EUR 521

Porcine CaSR ELISA Kit
EPC0544 96Tests
EUR 521

Calcium Sensing Receptor (CASR) Antibody (ATTO 390)
abx445328-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Calcium Sensing Receptor (CASR) Antibody (ATTO 488)
abx445329-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Calcium Sensing Receptor (CASR) Antibody (ATTO 565)
abx445330-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Calcium Sensing Receptor (CASR) Antibody (ATTO 594)
abx445331-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Calcium Sensing Receptor (CASR) Antibody (ATTO 633)
abx445332-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Calcium Sensing Receptor (CASR) Antibody (ATTO 655)
abx445333-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Calcium Sensing Receptor (CASR) Antibody (ATTO 680)
abx445334-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Calcium Sensing Receptor (CASR) Antibody (ATTO 700)
abx445335-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Rabbit Anti-Human Ca-Sensing Receptor 1 (CaSR) Antiserum #1
CASR11-S 100 ul
EUR 457

Guinea Pig CaSR ELISA Kit
EGC0544 96Tests
EUR 521

Casr ORF Vector (Rat) (pORF)
ORF064412 1.0 ug DNA
EUR 506

CASR ORF Vector (Human) (pORF)
ORF012578 1.0 ug DNA
EUR 95

Casr ORF Vector (Mouse) (pORF)
ORF040434 1.0 ug DNA
EUR 506

Recombinant Calcium Sensing Receptor (CASR)
4-RPC414Mu01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9QY96
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Calcium Sensing Receptor expressed in: E.coli

CASR ELISA Kit (Human) (OKAN04858)
OKAN04858 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is a plasma membrane G protein-coupled receptor that senses small changes in circulating calcium concentration. The encoded protein couples this information to intracellular signaling pathways that modify parathyroid hormone secretion or renal cation handling, and thus this protein plays an essential role in maintaining mineral ion homeostasis. Mutations in this gene are a cause of familial hypocalciuric hypercalcemia, neonatal severe hyperparathyroidism, and autosomal dominant hypocalcemia.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.118 ng/mL

CASR ELISA Kit (Rat) (OKCD02324)
OKCD02324 96 Wells
EUR 896
Description: Description of target: Senses changes in the extracellular concentration of calcium ions. The activity of this receptor is mediated by a G-protein that activates a phosphatidylinositol-calcium second messenger system. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.058 ng/mL

CASR ELISA Kit (Mouse) (OKCD02422)
OKCD02422 96 Wells
EUR 857
Description: Description of target: Senses changes in the extracellular concentration of calcium ions. The activity of this receptor is mediated by a G-protein that activates a phosphatidylinositol-calcium second messenger system. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

CASR ELISA Kit (Human) (OKCD08117)
OKCD08117 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene is a G protein-coupled receptor that is expressed in the parathyroid hormone (PTH)-producing chief cells of the parathyroid gland, and the cells lining the kidney tubule. It senses small changes in circulating calcium concentration and couples this information to intracellular signaling pathways that modify PTH secretion or renal cation handling, thus this protein plays an essential role in maintaining mineral ion homeostasis. Mutations in this gene cause familial hypocalciuric hypercalcemia, familial, isolated hypoparathyroidism, and neonatal severe primary hyperparathyroidism...;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.118ng/mL

CASR ELISA Kit (Human) (OKEH04207)
OKEH04207 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene is a G protein-coupled receptor that is expressed in the parathyroid hormone (PTH)-producing chief cells of the parathyroid gland, and the cells lining the kidney tubule. It senses small changes in circulating calcium concentration and couples this information to intracellular signaling pathways that modify PTH secretion or renal cation handling, thus this protein plays an essential role in maintaining mineral ion homeostasis. Mutations in this gene cause familial hypocalciuric hypercalcemia, familial, isolated hypoparathyroidism, and neonatal severe primary hyperparathyroidism.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

CASR ELISA Kit (Bovine) (OKEH08149)
OKEH08149 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.054ng/mL

CASR ELISA Kit (Pig) (OKEH08150)
OKEH08150 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Calcium Sensing Receptor Phospho-Thr888 (CASR pT888) Antibody
20-abx328125
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcium Sensing Receptor (CASR) Antibody (PE/ATTO 594)
abx445341-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

Mouse Calcium Sensing Receptor (CASR) Protein
20-abx167455
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CASR sgRNA CRISPR Lentivector set (Human)
K0366701 3 x 1.0 ug
EUR 339

Casr sgRNA CRISPR Lentivector set (Rat)
K6820601 3 x 1.0 ug
EUR 339

Casr sgRNA CRISPR Lentivector set (Mouse)
K4349301 3 x 1.0 ug
EUR 339

Rabbit Anti-Human Ca-Sensing Receptor 1 (CaSR) IgG #1, aff pure
CASR11-A 100 ul
EUR 482

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody
ABP57576-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody
ABP57577-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4c Rabbit Polyclonal Antibody
ABP57578-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG5 Rabbit Polyclonal Antibody
ABP57579-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG7 Rabbit Polyclonal Antibody
ABP57580-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG7
  • Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

CASR Rabbit Polyclonal Antibody