C7 Rabbit Polyclonal Antibody

C7 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

C7 Polyclonal Antibody

ES8422-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against C7 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

C7 Polyclonal Antibody

ABP57429-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human C7
  • Applications tips:
Description: A polyclonal antibody for detection of C7 from Human. This C7 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human C7

C7 Polyclonal Antibody

ABP57429-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human C7
  • Applications tips:
Description: A polyclonal antibody for detection of C7 from Human. This C7 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human C7

C7 Polyclonal Antibody

ABP57429-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human C7
  • Applications tips:
Description: A polyclonal antibody for detection of C7 from Human. This C7 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human C7

C7 Polyclonal Antibody

42095-100ul 100ul
EUR 333

Human Complement Component 7 (C7) ELISA Kit

DLR-C7-Hu-48T 48T
EUR 479
  • Should the Human Complement Component 7 (C7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Complement Component 7 (C7) in samples from serum, plasma or other biological fluids.

Human Complement Component 7 (C7) ELISA Kit

DLR-C7-Hu-96T 96T
EUR 621
  • Should the Human Complement Component 7 (C7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Complement Component 7 (C7) in samples from serum, plasma or other biological fluids.

Human Complement Component 7 (C7) ELISA Kit

RD-C7-Hu-48Tests 48 Tests
EUR 478

Human Complement Component 7 (C7) ELISA Kit

RD-C7-Hu-96Tests 96 Tests
EUR 662

Human Complement Component 7 (C7) ELISA Kit

RDR-C7-Hu-48Tests 48 Tests
EUR 500

Human Complement Component 7 (C7) ELISA Kit

RDR-C7-Hu-96Tests 96 Tests
EUR 692

C7 Rabbit pAb

A5394-100ul 100 ul
EUR 308

C7 Rabbit pAb

A5394-200ul 200 ul
EUR 459

C7 Rabbit pAb

A5394-20ul 20 ul
EUR 183

C7 Rabbit pAb

A5394-50ul 50 ul
EUR 223

C7 Polyclonal Conjugated Antibody

C42095 100ul
EUR 397

Complement C7 (C7) Antibody

20-abx141202
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Rabbit C7 ELISA Kit

ERTC0361 96Tests
EUR 521

C7 Antibody

ABD9410 100 ug
EUR 438

C7 Antibody

46376-100ul 100ul
EUR 252

C7 antibody

70R-16096 50 ul
EUR 435
Description: Rabbit polyclonal C7 antibody

C7 Antibody

DF9410 200ul
EUR 304
Description: C7 Antibody detects endogenous levels of total C7.

C7 Antibody

1-CSB-PA004145ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against C7. Recognizes C7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

C7 Antibody

1-CSB-PA004145GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against C7. Recognizes C7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Mouse Anti-Complement C7 Polyclonal Antibody

CTA-323-100ug 100ug Ask for price
Description: Mouse anti-complement C7 polyclonal antibody for WB.

Mouse Anti-Complement C7 Polyclonal Antibody

CTA-323-1mg 1mg Ask for price
Description: Mouse anti-complement C7 polyclonal antibody for WB.

C7 Conjugated Antibody

C46376 100ul
EUR 397

anti- C7 antibody

FNab01132 100µg
EUR 505.25
  • Immunogen: complement component 7
  • Uniprot ID: P10643
  • Gene ID: 730
  • Research Area: Immunology
Description: Antibody raised against C7

Complement C7 antibody

20C-CR2037G 1 ml
EUR 187
Description: Goat polyclonal Complement C7 antibody

Anti-C7 antibody

PAab01132 100 ug
EUR 355

Anti-C7 antibody

STJ97653 200 µl
EUR 197
Description: Rabbit polyclonal to C7.

Anti-C7 antibody

STJ27347 100 µl
EUR 277
Description: C7 is a component of the complement system. It participates in the formation of Membrane Attack Complex (MAC). People with C7 deficiency are prone to bacterial infection.

Complement Component 7 (C7) Polyclonal Antibody (Human)

4-PAA731Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Ser122~His456) linked with LEHHHHHH
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Complement Component 7 (C7)

Complement Component 7 (C7) Polyclonal Antibody (Pig)

4-PAA731Po01
  • EUR 259.00
  • EUR 2694.00
  • EUR 667.00
  • EUR 326.00
  • EUR 218.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Asn255~Asn399)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Complement Component 7 (C7)

Complement Component 7 (C7) Polyclonal Antibody (Pig)

4-PAA731Po02
  • EUR 259.00
  • EUR 2694.00
  • EUR 667.00
  • EUR 326.00
  • EUR 218.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Leu725~Cys838)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Complement Component 7 (C7)

Complement Component 7 (C7) Polyclonal Antibody (Rat)

4-PAA731Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Glu1~Ser144)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Complement Component 7 (C7)

C7 siRNA

20-abx909936
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-C7

YF-PA10577 50 ul
EUR 363
Description: Mouse polyclonal to C7

anti-C7

YF-PA10578 50 ug
EUR 363
Description: Mouse polyclonal to C7

anti-C7

YF-PA10579 100 ug
EUR 403
Description: Rabbit polyclonal to C7

Monoclonal RGS3 Antibody (clone 1E8-C7), Clone: 1E8-C7

AMM07597G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human RGS3 (clone 1E8-C7). The antibodies are raised in Mouse and are from clone 1E8-C7. This antibody is applicable in WB and IHC-P, IF, E

CD7(C7/511) Antibody

BNC610511-100 100uL
EUR 199
Description: Primary antibody against CD7(C7/511), CF660R conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC610511-500 500uL
EUR 544
Description: Primary antibody against CD7(C7/511), CF660R conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC680511-100 100uL
EUR 199
Description: Primary antibody against CD7(C7/511), CF568 conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC680511-500 500uL
EUR 544
Description: Primary antibody against CD7(C7/511), CF568 conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC400511-100 100uL
EUR 199
Description: Primary antibody against CD7(C7/511), CF640R conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC400511-500 500uL
EUR 544
Description: Primary antibody against CD7(C7/511), CF640R conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC430511-100 100uL
EUR 199
Description: Primary antibody against CD7(C7/511), CF543 conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC430511-500 500uL
EUR 544
Description: Primary antibody against CD7(C7/511), CF543 conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC470511-100 100uL
EUR 199
Description: Primary antibody against CD7(C7/511), CF647 conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC470511-500 500uL
EUR 544
Description: Primary antibody against CD7(C7/511), CF647 conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC550511-100 100uL
EUR 199
Description: Primary antibody against CD7(C7/511), CF555 conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC550511-500 500uL
EUR 544
Description: Primary antibody against CD7(C7/511), CF555 conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC040511-100 100uL
EUR 199
Description: Primary antibody against CD7(C7/511), CF405S conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC040511-500 500uL
EUR 544
Description: Primary antibody against CD7(C7/511), CF405S conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC050511-100 100uL
EUR 199
Description: Primary antibody against CD7(C7/511), CF405M conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC050511-500 500uL
EUR 544
Description: Primary antibody against CD7(C7/511), CF405M conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNUM0511-50 50uL
EUR 395
Description: Primary antibody against CD7(C7/511), 1mg/mL

CD7(C7/511) Antibody

BNC700511-100 100uL
EUR 199
Description: Primary antibody against CD7(C7/511), CF770 conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC700511-500 500uL
EUR 544
Description: Primary antibody against CD7(C7/511), CF770 conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC940511-100 100uL
EUR 199
Description: Primary antibody against CD7(C7/511), CF594 conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC940511-500 500uL
EUR 544
Description: Primary antibody against CD7(C7/511), CF594 conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNCH0511-100 100uL
EUR 199
Description: Primary antibody against CD7(C7/511), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNCH0511-500 500uL
EUR 544
Description: Primary antibody against CD7(C7/511), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC800511-100 100uL
EUR 199
Description: Primary antibody against CD7(C7/511), CF680 conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC800511-500 500uL
EUR 544
Description: Primary antibody against CD7(C7/511), CF680 conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC810511-100 100uL
EUR 199
Description: Primary antibody against CD7(C7/511), CF680R conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC810511-500 500uL
EUR 544
Description: Primary antibody against CD7(C7/511), CF680R conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNCP0511-250 250uL
EUR 383
Description: Primary antibody against CD7(C7/511), PerCP conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNCR0511-250 250uL
EUR 383
Description: Primary antibody against CD7(C7/511), RPE conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNCA0511-250 250uL
EUR 383
Description: Primary antibody against CD7(C7/511), APC conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNCAP0511-100 100uL
EUR 199
Description: Primary antibody against CD7(C7/511), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNCAP0511-500 500uL
EUR 544
Description: Primary antibody against CD7(C7/511), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNCB0511-100 100uL
EUR 199
Description: Primary antibody against CD7(C7/511), Biotin conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNCB0511-500 500uL
EUR 544
Description: Primary antibody against CD7(C7/511), Biotin conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC880511-100 100uL
EUR 199
Description: Primary antibody against CD7(C7/511), CF488A conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNC880511-500 500uL
EUR 544
Description: Primary antibody against CD7(C7/511), CF488A conjugate, Concentration: 0.1mg/mL

CD7(C7/511) Antibody

BNUB0511-100 100uL
EUR 209
Description: Primary antibody against CD7(C7/511), Concentration: 0.2mg/mL

CD7(C7/511) Antibody

BNUB0511-500 500uL
EUR 458
Description: Primary antibody against CD7(C7/511), Concentration: 0.2mg/mL

Anti-Complement C7 Antibody

A00844-1 100ug/vial
EUR 294

Human Complement C7 Antibody

45251-05011 150 ug
EUR 217

Human Complement C7 Antibody

15251-05011 150 ug
EUR 217

Human C7/ Complement component C7 ELISA Kit

E0320Hu 1 Kit
EUR 563

Human C7(Complement component C7) ELISA Kit

EH0656 96T
EUR 524.1
  • Detection range: 1.563-100 ng/ml
  • Uniprot ID: P10643
  • Alias: C7(Complement component C7)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Bovine Complement component C7, C7 ELISA KIT

ELI-02538b 96 Tests
EUR 928

Human Complement component C7, C7 ELISA KIT

ELI-02539h 96 Tests
EUR 824

Porcine Complement component C7, C7 ELISA KIT

ELI-02540p 96 Tests
EUR 928

Complement Component 7 (C7) Polyclonal Antibody (Human), APC

4-PAA731Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Ser122~His456) linked with LEHHHHHH
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Complement Component 7 (C7). This antibody is labeled with APC.

Complement Component 7 (C7) Polyclonal Antibody (Human), Biotinylated

4-PAA731Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Ser122~His456) linked with LEHHHHHH
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Complement Component 7 (C7). This antibody is labeled with Biotin.

Complement Component 7 (C7) Polyclonal Antibody (Human), Cy3

4-PAA731Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Ser122~His456) linked with LEHHHHHH
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Complement Component 7 (C7). This antibody is labeled with Cy3.

Complement Component 7 (C7) Polyclonal Antibody (Human), FITC

4-PAA731Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Ser122~His456) linked with LEHHHHHH
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Complement Component 7 (C7). This antibody is labeled with FITC.

Complement Component 7 (C7) Polyclonal Antibody (Human), HRP

4-PAA731Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Ser122~His456) linked with LEHHHHHH
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Complement Component 7 (C7). This antibody is labeled with HRP.

Complement Component 7 (C7) Polyclonal Antibody (Human), PE

4-PAA731Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Ser122~His456) linked with LEHHHHHH
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Complement Component 7 (C7). This antibody is labeled with PE.

Complement Component 7 (C7) Polyclonal Antibody (Pig), APC

4-PAA731Po01-APC
  • EUR 363.00
  • EUR 3527.00
  • EUR 975.00
  • EUR 465.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Asn255~Asn399)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Complement Component 7 (C7). This antibody is labeled with APC.

Complement Component 7 (C7) Polyclonal Antibody (Pig), Biotinylated

4-PAA731Po01-Biotin
  • EUR 324.00
  • EUR 2644.00
  • EUR 773.00
  • EUR 399.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Asn255~Asn399)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Complement Component 7 (C7). This antibody is labeled with Biotin.

Complement Component 7 (C7) Polyclonal Antibody (Pig), Cy3

4-PAA731Po01-Cy3
  • EUR 443.00
  • EUR 4661.00
  • EUR 1259.00
  • EUR 578.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Asn255~Asn399)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Complement Component 7 (C7). This antibody is labeled with Cy3.

Complement Component 7 (C7) Polyclonal Antibody (Pig), FITC

4-PAA731Po01-FITC
  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Asn255~Asn399)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Complement Component 7 (C7). This antibody is labeled with FITC.

Complement Component 7 (C7) Polyclonal Antibody (Pig), HRP

4-PAA731Po01-HRP
  • EUR 331.00
  • EUR 3073.00
  • EUR 862.00
  • EUR 419.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Asn255~Asn399)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Complement Component 7 (C7). This antibody is labeled with HRP.

Complement Component 7 (C7) Polyclonal Antibody (Pig), PE

4-PAA731Po01-PE
  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Asn255~Asn399)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Complement Component 7 (C7). This antibody is labeled with PE.

Complement Component 7 (C7) Polyclonal Antibody (Pig), APC

4-PAA731Po02-APC
  • EUR 363.00
  • EUR 3527.00
  • EUR 975.00
  • EUR 465.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Leu725~Cys838)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Complement Component 7 (C7). This antibody is labeled with APC.

Complement Component 7 (C7) Polyclonal Antibody (Pig), Biotinylated

4-PAA731Po02-Biotin
  • EUR 324.00
  • EUR 2644.00
  • EUR 773.00
  • EUR 399.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Leu725~Cys838)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Complement Component 7 (C7). This antibody is labeled with Biotin.

Complement Component 7 (C7) Polyclonal Antibody (Pig), Cy3

4-PAA731Po02-Cy3
  • EUR 443.00
  • EUR 4661.00
  • EUR 1259.00
  • EUR 578.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Leu725~Cys838)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Complement Component 7 (C7). This antibody is labeled with Cy3.

Complement Component 7 (C7) Polyclonal Antibody (Pig), FITC

4-PAA731Po02-FITC
  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Leu725~Cys838)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Complement Component 7 (C7). This antibody is labeled with FITC.

Complement Component 7 (C7) Polyclonal Antibody (Pig), HRP

4-PAA731Po02-HRP
  • EUR 331.00
  • EUR 3073.00
  • EUR 862.00
  • EUR 419.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Leu725~Cys838)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Complement Component 7 (C7). This antibody is labeled with HRP.

Complement Component 7 (C7) Polyclonal Antibody (Pig), PE

4-PAA731Po02-PE
  • EUR 310.00
  • EUR 2841.00
  • EUR 800.00
  • EUR 392.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Leu725~Cys838)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Complement Component 7 (C7). This antibody is labeled with PE.

Complement Component 7 (C7) Polyclonal Antibody (Rat), APC

4-PAA731Ra01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Glu1~Ser144)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Complement Component 7 (C7). This antibody is labeled with APC.

Complement Component 7 (C7) Polyclonal Antibody (Rat), Biotinylated

4-PAA731Ra01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Glu1~Ser144)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Complement Component 7 (C7). This antibody is labeled with Biotin.

Complement Component 7 (C7) Polyclonal Antibody (Rat), Cy3

4-PAA731Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Glu1~Ser144)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Complement Component 7 (C7). This antibody is labeled with Cy3.

Complement Component 7 (C7) Polyclonal Antibody (Rat), FITC

4-PAA731Ra01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Glu1~Ser144)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Complement Component 7 (C7). This antibody is labeled with FITC.

Complement Component 7 (C7) Polyclonal Antibody (Rat), HRP

4-PAA731Ra01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Glu1~Ser144)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Complement Component 7 (C7). This antibody is labeled with HRP.

Complement Component 7 (C7) Polyclonal Antibody (Rat), PE

4-PAA731Ra01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Glu1~Ser144)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Complement Component 7 (C7). This antibody is labeled with PE.

Rabbit Complement Component 7 (C7) ELISA Kit

abx362361-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

C7 cloning plasmid

CSB-CL004145HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2532
  • Sequence: atgaaggtgataagcttattcattttggtgggatttataggagagttccaaagtttttcaagtgcctcctctccagtcaactgccagtgggacttctatgccccttggtcagaatgcaatggctgtaccaagactcagactcgcaggcggtcagttgctgtgtatgggcagtatg
  • Show more
Description: A cloning plasmid for the C7 gene.

Complement C7 protein

32C-CP2033U 250 ug
EUR 430
Description: Purified Complement C7 protein isolated from human plasma

C7 Blocking Peptide

DF9410-BP 1mg
EUR 195

Complement Component 7 (C7) Antibody

20-abx111770
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Complement Component 7 (C7) Antibody

20-abx129075
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Complement Component 7 (C7) Antibody

20-abx130335
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Complement Component 7 (C7) Antibody

abx146404-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Complement Component 7 (C7) Antibody

abx148764-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Complement Component 7 (C7) Antibody

20-abx102000
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Complement Component 7 (C7) Antibody

20-abx102001
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Complement Component 7 (C7) Antibody

20-abx006774
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Complement Component 7 (C7) Antibody

20-abx320168
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

complement Component 7 (C7) Antibody

abx432533-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Complement Component 7 (C7) Antibody

abx231132-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Complement Component 7 (C7) Antibody

20-abx171892
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Complement Component 7 (C7) Polyclonal Antibody (Human), APC-Cy7

4-PAA731Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Ser122~His456) linked with LEHHHHHH
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Complement Component 7 (C7). This antibody is labeled with APC-Cy7.

Complement Component 7 (C7) Polyclonal Antibody (Pig), APC-Cy7

4-PAA731Po01-APC-Cy7
  • EUR 607.00
  • EUR 6934.00
  • EUR 1831.00
  • EUR 810.00
  • EUR 333.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Asn255~Asn399)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Complement Component 7 (C7). This antibody is labeled with APC-Cy7.

Complement Component 7 (C7) Polyclonal Antibody (Pig), APC-Cy7

4-PAA731Po02-APC-Cy7
  • EUR 607.00
  • EUR 6934.00
  • EUR 1831.00
  • EUR 810.00
  • EUR 333.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Leu725~Cys838)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Complement Component 7 (C7). This antibody is labeled with APC-Cy7.

Complement Component 7 (C7) Polyclonal Antibody (Rat), APC-Cy7

4-PAA731Ra01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: C7 (Glu1~Ser144)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Complement Component 7 (C7). This antibody is labeled with APC-Cy7.

Monoclonal ACTA1 / ASMA Antibody (clone 5C5.F8.C7), Clone: 5C5.F8.C7

AMM01963G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human ACTA1 / ASMA (clone 5C5.F8.C7). The antibodies are raised in Mouse and are from clone 5C5.F8.C7. This antibody is applicable in IHC-P, IF

Mouse Anti Human C7 Monoclonal Antibody

CABT-47921MH 0.1 mg
EUR 840

Complement Component 7 (C7) Antibody (FITC)

20-abx271268
  • EUR 509.00
  • EUR 258.00
  • EUR 1511.00
  • EUR 704.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Complement Component 7 (C7) Antibody (Biotin)

20-abx271534
  • EUR 481.00
  • EUR 244.00
  • EUR 1400.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Complement C7 Antibody (Biotin Conjugate)

45251-05021 150 ug
EUR 276

Human Complement C7 Antibody (Biotin Conjugate)

15251-05021 150 ug
EUR 276

Anti-Elafin/Skalp Antibody (monoclonal, C7)

M00364 100ug/vial
EUR 334

Human C7 ELISA Kit

EHC0361 96Tests
EUR 521

Human C7 ELISA Kit

ELA-E0731h 96 Tests
EUR 824

Goat C7 ELISA Kit

EGTC0361 96Tests
EUR 521

Canine C7 ELISA Kit

ECC0361 96Tests
EUR 521

Chicken C7 ELISA Kit

ECKC0361 96Tests
EUR 521

Bovine C7 ELISA Kit

EBC0361 96Tests
EUR 521

Anserini C7 ELISA Kit

EAC0361 96Tests
EUR 521

C7 ELISA KIT|Human

EF000425 96 Tests
EUR 689

Porcine C7 ELISA Kit

EPC0361 96Tests
EUR 521

Rat C7 ELISA Kit

ERC0361 96Tests
EUR 521

Sheep C7 ELISA Kit

ESC0361 96Tests
EUR 521

Mouse C7 ELISA Kit

EMC0361 96Tests
EUR 521

Monkey C7 ELISA Kit

EMKC0361 96Tests
EUR 521

Complement C7 Blocking Peptide

20-abx061900
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Human C7 shRNA Plasmid

20-abx950507
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-RGS3 (1E8-C7)

YF-MA10783 100 ug
EUR 363
Description: Mouse monoclonal to RGS3

Human Complement C7 AssayLite Antibody (FITC Conjugate)

15251-05041 150 ug
EUR 428

Human Complement C7 AssayLite Antibody (RPE Conjugate)

15251-05051 150 ug
EUR 428

Human Complement C7 AssayLite Antibody (APC Conjugate)

15251-05061 150 ug
EUR 428

Human Complement C7 AssayLite Antibody (PerCP Conjugate)

15251-05071 150 ug
EUR 471

Anti-Complement C7 Monoclonal Antibody (030-113.7.5.4)

CTA-134-100ug 100ug Ask for price
Description: Mouse anti-complement C7 monoclonal antibody (030-113.7.5.4) for WB, ELISA.

Anti-Complement C7 Monoclonal Antibody (030-113.7.5.4)

CTA-134-1mg 1mg Ask for price
Description: Mouse anti-complement C7 monoclonal antibody (030-113.7.5.4) for WB, ELISA.

3?-Amino-Modifier C7 CPG

AHP-CH-AMI0103 100 mg Ask for price
    • Product line: Oligo Modification CPG
    • Brand:

3?-Amino-Modifier C7 CPG

AHP-CH-AMI1003 1000 mg Ask for price
    • Product line: Oligo Modification CPG
    • Brand:

Guinea Pig C7 ELISA Kit

EGC0361 96Tests
EUR 521

C7 ORF Vector (Human) (pORF)

ORF001689 1.0 ug DNA
EUR 95

C7 ORF Vector (Mouse) (pORF)

ORF040147 1.0 ug DNA
EUR 506

Recombinant Complement Component 7 (C7)

4-RPA731Hu01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P10643
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.1kDa
  • Isoelectric Point: 8.7
Description: Recombinant Human Complement Component 7 expressed in: E.coli

Recombinant Complement Component 7 (C7)

4-RPA731Po01
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9TUQ3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 48.2kDa
  • Isoelectric Point: 6.1
Description: Recombinant Pig Complement Component 7 expressed in: E.coli

Recombinant Complement Component 7 (C7)

4-RPA731Po02
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9TUQ3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 39.5kDa
  • Isoelectric Point: 6.3
Description: Recombinant Pig Complement Component 7 expressed in: E.coli

Recombinant Complement Component 7 (C7)

4-RPA731Ra01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9ERF0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Complement Component 7 expressed in: E.coli

Anti-G gamma14 (1G11-C7)

YF-MA13281 100 ug
EUR 363
Description: Mouse monoclonal to G gamma14

C7 ELISA Kit (Human) (OKCD06740)

OKCD06740 96 Wells
EUR 753
Description: Description of target: This gene encodes a serum glycoprotein that forms a membrane attack complex together with complement components C5b, C6, C8, and C9 as part of the terminal complement pathway of the innate immune system. The protein encoded by this gene contains a cholesterol-dependent cytolysin/membrane attack complex/perforin-like (CDC/MACPF) domain and belongs to a large family of structurally related molecules that form pores involved in host immunity and bacterial pathogenesis. This protein initiates membrane attack complex formation by binding the C5b-C6 subcomplex and inserts into the phospholipid bilayer, serving as a membrane anchor. Mutations in this gene are associated with a rare disorder called C7 deficiency.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.4ng/mL

Monoclonal RGS3 Antibody (monoclonal) (M01), Clone: 1E8-C7

AMM07598G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RGS3 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1E8-C7. This antibody is applicable in WB, IHC and IF, E

Monoclonal GNGT2 Antibody (monoclonal) (M01), Clone: 1G11-C7

APR16190G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human GNGT2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1G11-C7. This antibody is applicable in WB, E

Human Complement C7 AssayMax ELISA Kit

EC7101-1 96 Well Plate
EUR 417

Human Complement 7 (C7) Purified Protein

HC715-R-100 100 ug
EUR 347

Human Complement 7(C7)ELISA Kit

GA-E0357HM-48T 48T
EUR 289

Human Complement 7(C7)ELISA Kit

GA-E0357HM-96T 96T
EUR 466

C7 sgRNA CRISPR Lentivector set (Human)

K0252801 3 x 1.0 ug
EUR 339

Pig Complement Component 7 (C7) Protein

20-abx066062
  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Pig Complement Component 7 (C7) Protein

20-abx066063
  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Complement Component 7 (C7) Protein

20-abx167779
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Complement Component 7 (C7) Protein

20-abx167130
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Complement 7,C7 ELISA Kit

201-12-0341 96 tests
EUR 440
  • This Complement 7 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

C7 sgRNA CRISPR Lentivector set (Mouse)

K4390201 3 x 1.0 ug
EUR 339

Human Complement 7, C7 ELISA Kit

CSB-E11167h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Complement 7, C7 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Complement 7, C7 ELISA Kit

1-CSB-E11167h
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Complement 7, C7 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Complement 7,C7 ELISA Kit

CN-03714H1 96T
EUR 455

Human Complement 7,C7 ELISA Kit

CN-03714H2 48T
EUR 304

Human Complement 7(C7)ELISA Kit

QY-E04098 96T
EUR 361

anti-RNA polymerase III subunit C7

YF-PA17107 50 ul
EUR 363
Description: Mouse polyclonal to RNA polymerase III subunit C7

Monkey Complement Component 7 (C7) ELISA Kit

abx359778-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Complement Component 7 (C7) ELISA Kit

abx361551-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Cow Complement Component 7 (C7) ELISA Kit

abx513861-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Pig Complement Component 7 (C7) ELISA Kit

abx513863-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Complement Component 7 (C7) ELISA Kit

abx573674-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

ELISA kit for Human Complement component C7

EK2188 96 tests
EUR 536
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Complement component C7 in samples from serum, plasma, tissue homogenates and other biological fluids.

C7 sgRNA CRISPR Lentivector (Human) (Target 1)

K0252802 1.0 ug DNA
EUR 154

C7 sgRNA CRISPR Lentivector (Human) (Target 2)

K0252803 1.0 ug DNA
EUR 154

C7 sgRNA CRISPR Lentivector (Human) (Target 3)

K0252804 1.0 ug DNA
EUR 154

Human Complement Component 7 (C7) ELISA Kit

20-abx150874
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Complement Component 7 (C7) ELISA Kit

abx051904-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Sheep Complement Component 7 (C7) ELISA Kit

abx364709-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

C7 Rabbit Polyclonal Antibody