Axl Rabbit Polyclonal Antibody

Axl Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

Polyclonal AXL Antibody
APR05948G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AXL . This antibody is tested and proven to work in the following applications:
Axl Polyclonal Antibody
ABP57379-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y691
  • Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y691
Axl Polyclonal Antibody
ABP57379-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y691
  • Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y691
Axl Polyclonal Antibody
ABP57379-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y691
  • Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y691
Axl Polyclonal Antibody
ABP55772-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y697
  • Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y697
Axl Polyclonal Antibody
ABP55772-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y697
  • Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y697
Axl Polyclonal Antibody
ABP55772-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Axl around the non-phosphorylation site of Y697
  • Applications tips:
Description: A polyclonal antibody for detection of Axl from Human, Mouse, Rat. This Axl antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the non-phosphorylation site of Y697
Axl Polyclonal Antibody
ES8372-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Axl from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Axl Polyclonal Antibody
ES8372-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Axl from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Axl Polyclonal Antibody
ES6771-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Axl from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA
Axl Polyclonal Antibody
ES6771-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Axl from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA
AXL Rabbit pAb
A0532-100ul 100 ul
EUR 308
AXL Rabbit pAb
A0532-200ul 200 ul
EUR 459
AXL Rabbit pAb
A0532-20ul 20 ul Ask for price
AXL Rabbit pAb
A0532-50ul 50 ul Ask for price
AXL Rabbit pAb
A17874-100ul 100 ul
EUR 308
AXL Rabbit pAb
A17874-200ul 200 ul
EUR 459
AXL Rabbit pAb
A17874-20ul 20 ul
EUR 183
AXL Rabbit pAb
A17874-50ul 50 ul
EUR 223
AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat)
4-PAL230Ra01
  • EUR 275.00
  • EUR 2958.00
  • EUR 727.00
  • EUR 350.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL)
AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), APC
4-PAL230Ra01-APC
  • EUR 388.00
  • EUR 3887.00
  • EUR 1065.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with APC.
AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), Biotinylated
4-PAL230Ra01-Biotin
  • EUR 343.00
  • EUR 2908.00
  • EUR 839.00
  • EUR 425.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with Biotin.
AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), Cy3
4-PAL230Ra01-Cy3
  • EUR 476.00
  • EUR 5141.00
  • EUR 1379.00
  • EUR 626.00
  • EUR 275.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with Cy3.
AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), FITC
4-PAL230Ra01-FITC
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with FITC.
AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), HRP
4-PAL230Ra01-HRP
  • EUR 353.00
  • EUR 3385.00
  • EUR 940.00
  • EUR 451.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with HRP.
AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), PE
4-PAL230Ra01-PE
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with PE.
Axl (Phospho-Tyr691) Polyclonal Antibody
12335-100ul 100ul
EUR 252
Axl (Phospho-Tyr691) Polyclonal Antibody
12335-50ul 50ul
EUR 187
Polyclonal AXL Antibody (C-term)
APR05947G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AXL (C-term). This antibody is tested and proven to work in the following applications:
Axl (phospho Tyr691) Polyclonal Antibody
ABP55771-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Axl around the phosphorylation site of Y691
  • Applications tips:
Description: A polyclonal antibody for detection of Axl phospho Tyr691) from Human, Mouse, Rat. This Axl phospho Tyr691) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the phosphorylation site of Y691
Axl (phospho Tyr691) Polyclonal Antibody
ABP55771-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Axl around the phosphorylation site of Y691
  • Applications tips:
Description: A polyclonal antibody for detection of Axl phospho Tyr691) from Human, Mouse, Rat. This Axl phospho Tyr691) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the phosphorylation site of Y691
Axl (phospho Tyr691) Polyclonal Antibody
ABP55771-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Axl around the phosphorylation site of Y691
  • Applications tips:
Description: A polyclonal antibody for detection of Axl phospho Tyr691) from Human, Mouse, Rat. This Axl phospho Tyr691) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Axl around the phosphorylation site of Y691
Axl (phospho Tyr691) Polyclonal Antibody
ES6770-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Axl (phospho Tyr691) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
Axl (phospho Tyr691) Polyclonal Antibody
ES6770-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Axl (phospho Tyr691) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
AXL Antibody
48205-100ul 100ul
EUR 333
AXL Antibody
48205-50ul 50ul
EUR 239
Axl Antibody
39365-100ul 100ul
EUR 390
AXL antibody
10R-1995 100 ul
EUR 327
Description: Mouse monoclonal AXL antibody
AXL antibody
10R-2051 100 ul
EUR 403
Description: Mouse monoclonal AXL antibody
AXL Antibody
1-CSB-PA297707
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AXL. Recognizes AXL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
AXL Antibody
1-CSB-PA326981LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AXL. Recognizes AXL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200
AXL Antibody
1-CSB-PA030245
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against AXL. Recognizes AXL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000
AXL antibody
70R-9655 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal AXL antibody
AXL antibody
70R-51253 100 ul
EUR 287
Description: Purified Polyclonal AXL antibody
AXL Antibody
BF0290 200ul
EUR 376
Description: AXL antibody detects endogenous levels of total AXL.
AXL Antibody
AF7793 200ul
EUR 376
Description: AXL Antibody detects endogenous levels of AXL.
AXL Antibody
AF8412 200ul
EUR 376
Description: AXL Antibody detects endogenous levels of total AXL.
AXL Antibody
ABF8412 100 ug
EUR 438
AXL Receptor Tyrosine Kinase (AXL) Polyclonal Antibody (Rat), APC-Cy7
4-PAL230Ra01-APC-Cy7
  • EUR 657.00
  • EUR 7654.00
  • EUR 2011.00
  • EUR 882.00
  • EUR 355.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AXL (Lys21~His202)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat AXL Receptor Tyrosine Kinase (AXL). This antibody is labeled with APC-Cy7.
Axl (Phospho-Tyr691) Polyclonal Polyclonal Conjugated Antibody
C12335 100ul
EUR 397
AXL (Phospho-Tyr702) Polyclonal Conjugated Antibody
C12791 100ul
EUR 397
Phospho-AXL-Y702 Rabbit pAb
AP0848-100ul 100 ul
EUR 384
Phospho-AXL-Y702 Rabbit pAb
AP0848-200ul 200 ul
EUR 554
Phospho-AXL-Y702 Rabbit pAb
AP0848-20ul 20 ul
EUR 183
Phospho-AXL-Y702 Rabbit pAb
AP0848-50ul 50 ul
EUR 265
Anti-AXL Antibody
A00226-2 100ug/vial
EUR 294
AXL antibody (Tyr691)
70R-32634 100 ug
EUR 327
Description: Rabbit polyclonal AXL antibody (Tyr691)
AXL (pT697) Antibody
20-abx009871
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
AXL (pY691) Antibody
abx148474-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
AXL (pY702) Antibody
abx148475-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
AXL (pY691) Antibody
20-abx249424
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
AXL Conjugated Antibody
C48205 100ul
EUR 397
anti- AXL antibody
FNab00754 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:3000
  • IP: 1:500-1:2000
  • Immunogen: AXL receptor tyrosine kinase
  • Uniprot ID: P30530
  • Gene ID: 558
  • Research Area: Cancer, Immunology, Signal Transduction, Metabolism
Description: Antibody raised against AXL
Anti-AXL antibody
PAab00754 100 ug
EUR 355
Anti-AXL antibody
STJ119885 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene.
Anti-Axl antibody
STJ91791 200 µl
EUR 197
Description: Rabbit polyclonal to Axl.
Anti-Axl Antibody
STJ500198 100 µg
EUR 476
Anti-AXL antibody
STJ22748 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene.
Anti-Axl antibody
STJ97643 200 µl
EUR 197
Description: Rabbit polyclonal to Axl.
Anti-Axl antibody
STJ97856 100 µl
EUR 234
Description: Mouse monoclonal to Axl.
Anti-Axl antibody
STJ97857 100 µl
EUR 234
Description: Mouse monoclonal to Axl.
Recombinant AXL Receptor Tyrosine Kinase (AXL)
4-RPL230Hu01
  • EUR 474.53
  • EUR 230.00
  • EUR 1504.48
  • EUR 568.16
  • EUR 1036.32
  • EUR 380.00
  • EUR 3611.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8kDa
  • Isoelectric Point: 4.6
Description: Recombinant Human AXL Receptor Tyrosine Kinase expressed in: E.coli
Recombinant AXL Receptor Tyrosine Kinase (AXL)
4-RPL230Ra01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8VIA0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat AXL Receptor Tyrosine Kinase expressed in: E.coli
AXL siRNA
20-abx908739
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
AXL siRNA
20-abx908740
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-AXL
YF-PA10419 50 ul
EUR 363
Description: Mouse polyclonal to AXL
anti-AXL
YF-PA10420 50 ug
EUR 363
Description: Mouse polyclonal to AXL
anti-AXL
YF-PA10421 100 ug
EUR 403
Description: Rabbit polyclonal to AXL
anti-AXL
YF-PA23279 50 ul
EUR 334
Description: Mouse polyclonal to AXL
anti-AXL
YF-PA27171 100 ul
EUR 403
Description: Rabbit polyclonal to AXL
AXL (Phospho-Tyr703) Antibody
13143-100ul 100ul
EUR 252
AXL (Phospho-Tyr703) Antibody
13143-50ul 50ul
EUR 187
AXL (Phospho-Tyr702) Antibody
12791-100ul 100ul
EUR 252
AXL (Phospho-Tyr702) Antibody
12791-50ul 50ul
EUR 187
AXL Antibody, HRP conjugated
1-CSB-PA326981LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AXL. Recognizes AXL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
AXL Antibody, FITC conjugated
1-CSB-PA326981LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AXL. Recognizes AXL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
AXL Antibody, Biotin conjugated
1-CSB-PA326981LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AXL. Recognizes AXL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Phospho-AXL (Y691) Antibody
1-CSB-PA030244
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-AXL (Y691). Recognizes Phospho-AXL (Y691) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
Phospho-AXL (Tyr703) Antibody
AF7293 200ul
EUR 376
Description: Phospho-AXL (Tyr703) Antibody detects endogenous levels of AXL only when phosphorylated at Tyr703.
Phospho-AXL (Tyr691) Antibody
AF8522 200ul
EUR 376
Description: AXL (Phospho-Tyr691) Antibody detects endogenous levels of AXL only when phosphorylated at Tyr691.
Phospho-AXL (Tyr702) Antibody
AF8523 200ul
EUR 376
Description: AXL (Phospho-Tyr702) Antibody detects endogenous levels of AXL only when phosphorylated at Tyr702.
AXL (Phospho- Tyr691) Antibody
ABF8522 100 ug
EUR 438
AXL (Phospho- Tyr702) Antibody
ABF8523 100 ug
EUR 438
Anti-Axl Antibody BIOTIN
STJ500199 100 µg
EUR 586
Anti-Axl Antibody FITC
STJ500200 100 µg
EUR 586
Rabbit Anti-Mouse AXL protein IgG-Biotinylated
AXL11-BTN 100 ul
EUR 529
Rabbit Anti-Human AXL protein IgG-Biotinylated
AXL12-BTN 100 ul
EUR 529
Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit
SEL230Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human AXL Receptor Tyrosine Kinase (AXL) in serum, plasma, tissue homogenates and other biological fluids.
Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit
SEL230Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human AXL Receptor Tyrosine Kinase (AXL) in serum, plasma, tissue homogenates and other biological fluids.
Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit
SEL230Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human AXL Receptor Tyrosine Kinase (AXL) in serum, plasma, tissue homogenates and other biological fluids.
Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit
SEL230Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human AXL Receptor Tyrosine Kinase (AXL) in serum, plasma, tissue homogenates and other biological fluids.
Human AXL Receptor Tyrosine Kinase (AXL) ELISA Kit
4-SEL230Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as AXL Receptor Tyrosine Kinase elisa. Alternative names of the recognized antigen: UFO
  • JTK11
  • Tyrosine-protein kinase receptor UFO
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human AXL Receptor Tyrosine Kinase (AXL) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Rat AXL Receptor Tyrosine Kinase (AXL) ELISA Kit
SEL230Ra-10x96wellstestplate 10x96-wells test plate
EUR 5621.62
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat AXL Receptor Tyrosine Kinase (AXL) in serum, plasma and other biological fluids.
Rat AXL Receptor Tyrosine Kinase (AXL) ELISA Kit
SEL230Ra-1x48wellstestplate 1x48-wells test plate
EUR 550.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat AXL Receptor Tyrosine Kinase (AXL) in serum, plasma and other biological fluids.
Rat AXL Receptor Tyrosine Kinase (AXL) ELISA Kit
SEL230Ra-1x96wellstestplate 1x96-wells test plate
EUR 743.72
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat AXL Receptor Tyrosine Kinase (AXL) in serum, plasma and other biological fluids.
Rat AXL Receptor Tyrosine Kinase (AXL) ELISA Kit
SEL230Ra-5x96wellstestplate 5x96-wells test plate
EUR 3046.74
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat AXL Receptor Tyrosine Kinase (AXL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat AXL Receptor Tyrosine Kinase (AXL) in serum, plasma and other biological fluids.
Rat AXL Receptor Tyrosine Kinase (AXL) ELISA Kit
4-SEL230Ra
  • EUR 5672.00
  • EUR 2997.00
  • EUR 744.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as AXL Receptor Tyrosine Kinase elisa. Alternative names of the recognized antigen: UFO
  • JTK11
  • Tyrosine-protein kinase receptor UFO
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat AXL Receptor Tyrosine Kinase (AXL) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.
AXL Blocking Peptide
33R-7673 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AXL antibody, catalog no. 70R-9655
AXL Blocking Peptide
20-abx061788
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
AXL Blocking Peptide
BF0290-BP 1mg
EUR 195
AXL cloning plasmid
CSB-CL326981HU-10ug 10ug
EUR 861
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2685
  • Sequence: atggcgtggcggtgccccaggatgggcagggtcccgctggcctggtgcttggcgctgtgcggctgggcgtgcatggcccccaggggcacgcaggctgaagaaagtcccttcgtgggcaacccagggaatatcacaggtgcccggggactcacgggcacccttcggtgtcagctcc
  • Show more
Description: A cloning plasmid for the AXL gene.
AXL Blocking Peptide
AF7793-BP 1mg
EUR 195
AXL Blocking Peptide
AF8412-BP 1mg
EUR 195
anti-AXL (1B3A2)
LF-MA30204 100 ul
EUR 425
Description: Mouse Monoclonal to AXL
anti-AXL (7E10)
LF-MA30273 100 ul
EUR 486
Description: Mouse Monoclonal to AXL
pDONR223-AXL Plasmid
PVTB00185S 2 ug
EUR 356
Anti-AXL (6C8)
YF-MA10084 100 ug
EUR 363
Description: Mouse monoclonal to AXL
Anti-AXL (6G1)
YF-MA10085 100 ug
EUR 363
Description: Mouse monoclonal to AXL
Anti-Axl (2C10)
YF-MA12092 100 ug
EUR 363
Description: Mouse monoclonal to Axl
AXL (Phospho-Tyr703) Conjugated Antibody
C13143 100ul
EUR 397
Anti-Phospho-AXL-Y702 antibody
STJ11100989 100 µl
EUR 393
Description: The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene.
Anti-Phospho-Axl (Y691) antibody
STJ90939 200 µl
EUR 197
Description: Axl is a protein encoded by the AXL gene which is approximately 98,3 kDa. Axl is localised to the cell membrane. It is involved in the GPCR pathway, ERK signalling, actin nucleation by ARP-WASP complex and activation of cAMP-dependent PKA. This protein falls under the Tyro3-Axl-Mer receptor tyrosine kinase subfamily. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6. Axl is expressed in primary colon tumors but weakly expressed in normal colon tissue. Mutations in the AXL gene may result in lymphocytic choriomeningitis, femoral neuropathy and Borna disease. STJ90939 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This primary antibody specifically binds to endogenous Axl protein which only binds about Y691 when Y691 is phosphorylated.
Rabbit Anti-Mouse AXL protein IgG, aff pure
AXL11-A 100 ul
EUR 482
Rabbit Anti-Human AXL protein IgG, aff pure
AXL12-A 100 ul
EUR 482
Rabbit Anti-Human AXL (phosphoY821) IgG (aff pure)
AB-23085-A 100ug
EUR 482
ELISA kit for Human AXL (AXL Receptor Tyrosine Kinase)
ELK7559 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to AXL Receptor Tyrosine Kinase (AXL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of AXL Receptor Tyrosine Kinase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Rat AXL (AXL Receptor Tyrosine Kinase)
ELK8078 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to AXL Receptor Tyrosine Kinase (AXL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of AXL Receptor Tyrosine Kinase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
AXL (pY697) Blocking Peptide
20-abx064128
  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
AXL ELISA KIT|Human
EF008027 96 Tests
EUR 689
Mouse AXL shRNA Plasmid
20-abx973661
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human AXL shRNA Plasmid
20-abx950384
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human AXL (phosphoY821) peptide
AB-23085-P 100ug
EUR 164
Human AXL ELISA Kit
LF-EK50867 1×96T
EUR 648
Mouse AXL ELISA Kit
LF-EK50868 1×96T
EUR 648
pCMV-SPORT6-AXL Plasmid
PVT16334 2 ug
EUR 325
Recombinant Human Axl Protein
RP00087 5 μg
EUR 136
Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx015709-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.
Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx036741-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
20-abx130417
  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
20-abx141090
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
20-abx171380
  • EUR 982.00
  • EUR 495.00
  • 1 mg
  • 200 ug
  • Please enquire.
Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx011796-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.
Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx033505-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx033505-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx033506-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx033506-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx033507-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx033507-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx028539-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
abx028539-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
20-abx326400
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tyrosine-Protein Kinase Receptor UFO (AXL) Antibody
20-abx327038
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Axl Rabbit Polyclonal Antibody