ATP5J2 Rabbit Polyclonal Antibody

ATP5J2 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

ATP5J2 Polyclonal Antibody
ABP57058-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the C-terminal region of human ATP5J2 Applications tips:
Description: A polyclonal antibody for detection of ATP5J2 from Human. This ATP5J2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ATP5J2

ATP5J2 Polyclonal Antibody
ABP57058-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human ATP5J2 Applications tips:
Description: A polyclonal antibody for detection of ATP5J2 from Human. This ATP5J2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ATP5J2

ATP5J2 Polyclonal Antibody
ABP57058-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human ATP5J2 Applications tips:
Description: A polyclonal antibody for detection of ATP5J2 from Human. This ATP5J2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ATP5J2

ATP5J2 Rabbit pAb
A17055-100ul	Abclonal	100 ul	EUR 308

ATP5J2 Rabbit pAb
A17055-200ul	Abclonal	200 ul	EUR 459

ATP5J2 Rabbit pAb
A17055-20ul	Abclonal	20 ul	EUR 183

ATP5J2 Rabbit pAb
A17055-50ul	Abclonal	50 ul	EUR 223

ATP5J2 Antibody
20-abx323086	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

ATP5J2 Antibody
ABD8505	Lifescience Market	100 ug	EUR 438

ATP5J2 Antibody
45316-100ul	SAB	100ul	EUR 252

ATP5J2 Antibody
45316-50ul	SAB	50ul	EUR 187

ATP5J2 Antibody
DF8505	Affbiotech	200ul	EUR 304
Description: ATP5J2 Antibody detects endogenous levels of total ATP5J2.

ATP5J2 Antibody
1-CSB-PA080021	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ATP5J2. Recognizes ATP5J2 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

ATP5J2 Conjugated Antibody
C45316	SAB	100ul	EUR 397

Anti-ATP5J2 Antibody
A12564	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal ATP5J2 Antibody. Validated in IHC and tested in Human.

Anti-ATP5J2 antibody
STJ91773	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to ATP5J2.

ATP5J2 siRNA
20-abx900534	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ATP5J2 siRNA
20-abx908582	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ATP5J2 siRNA
20-abx908583	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ATP5J2 Blocking Peptide
DF8505-BP	Affbiotech	1mg	EUR 195

ATP5J2 cloning plasmid
CSB-CL002370HU-10ug	Cusabio	10ug	EUR 189
Formulation: 10 μg plasmid + 200μl Glycerol Length: 285 Sequence: atggcgtcagttggtgagtgtccggccccagtaccagtgaaggacaagaaacttctggaggtcaaacttctggagctgccaagctggatcttgatgcgggacttcagtcctagtggcattttcggagcgtttcaaagaggttactaccggtactacaacaagtacatcaatgtgaa Show more
Description: A cloning plasmid for the ATP5J2 gene.

Mouse ATP5J2 shRNA Plasmid
20-abx974994	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ATP5J2 shRNA Plasmid
20-abx956352	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat ATP5J2 shRNA Plasmid
20-abx991203	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ATP5J2 Recombinant Protein (Human)
RP047926	ABM	100 ug	Ask for price

ATP5J2 Recombinant Protein (Mouse)
RP118013	ABM	100 ug	Ask for price

Rabbit ATP synthase subunit f, mitochondrial(ATP5J2) ELISA kit
E04A1103-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP synthase subunit f, mitochondrial(ATP5J2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP synthase subunit f, mitochondrial(ATP5J2) ELISA kit
E04A1103-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP synthase subunit f, mitochondrial(ATP5J2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP synthase subunit f, mitochondrial(ATP5J2) ELISA kit
E04A1103-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP synthase subunit f, mitochondrial(ATP5J2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ATP Synthase Subunit F, Mitochondrial (ATP5J2) Antibody
20-abx148414	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

ATP Synthase Subunit F, Mitochondrial (ATP5J2) Antibody
abx032488-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

ATP Synthase Subunit F, Mitochondrial (ATP5J2) Antibody
abx032488-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Atp5j2 ORF Vector (Mouse) (pORF)
ORF039339	ABM	1.0 ug DNA	EUR 506

ATP5J2 ORF Vector (Human) (pORF)
ORF015976	ABM	1.0 ug DNA	EUR 405

ATP5J2-PTCD1 Recombinant Protein (Human)
RP047929	ABM	100 ug	Ask for price

ATP5J2 sgRNA CRISPR Lentivector set (Human)
K0149501	ABM	3 x 1.0 ug	EUR 339

Atp5j2 sgRNA CRISPR Lentivector set (Mouse)
K4625201	ABM	3 x 1.0 ug	EUR 339

ATP5J2-PTCD1 ORF Vector (Human) (pORF)
ORF015977	ABM	1.0 ug DNA	Ask for price

ATP5J2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0149502	ABM	1.0 ug DNA	EUR 154

ATP5J2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0149503	ABM	1.0 ug DNA	EUR 154

ATP5J2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0149504	ABM	1.0 ug DNA	EUR 154

ATP5J2-PTCD1 sgRNA CRISPR Lentivector set (Human)
K2749001	ABM	3 x 1.0 ug	EUR 339

Atp5j2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4625202	ABM	1.0 ug DNA	EUR 154

Atp5j2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4625203	ABM	1.0 ug DNA	EUR 154

Atp5j2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4625204	ABM	1.0 ug DNA	EUR 154

ATP5J2 Protein Vector (Human) (pPB-C-His)
PV063901	ABM	500 ng	EUR 552

ATP5J2 Protein Vector (Human) (pPB-N-His)
PV063902	ABM	500 ng	EUR 552

ATP5J2 Protein Vector (Human) (pPM-C-HA)
PV063903	ABM	500 ng	EUR 552

ATP5J2 Protein Vector (Human) (pPM-C-His)
PV063904	ABM	500 ng	EUR 552

ATP5J2 Protein Vector (Human) (pPB-His-MBP)
PV325258	ABM	500 ng	EUR 552

ATP5J2 Protein Vector (Human) (pPB-His-GST)
PV325259	ABM	500 ng	EUR 552

ATP5J2 Protein Vector (Mouse) (pPB-C-His)
PV157354	ABM	500 ng	EUR 603

ATP5J2 Protein Vector (Mouse) (pPB-N-His)
PV157355	ABM	500 ng	EUR 603

ATP5J2 Protein Vector (Mouse) (pPM-C-HA)
PV157356	ABM	500 ng	EUR 603

ATP5J2 Protein Vector (Mouse) (pPM-C-His)
PV157357	ABM	500 ng	EUR 603

Atp5j2 3'UTR Luciferase Stable Cell Line
TU201089	ABM	1.0 ml	Ask for price

Atp5j2 3'UTR GFP Stable Cell Line
TU152332	ABM	1.0 ml	Ask for price

ATP5J2 3'UTR Luciferase Stable Cell Line
TU001421	ABM	1.0 ml	EUR 1394

Atp5j2 3'UTR Luciferase Stable Cell Line
TU102332	ABM	1.0 ml	Ask for price

ATP5J2 3'UTR GFP Stable Cell Line
TU051421	ABM	1.0 ml	EUR 1394

Atp5j2 3'UTR GFP Stable Cell Line
TU251089	ABM	1.0 ml	Ask for price

ATP5J2-PTCD1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2749002	ABM	1.0 ug DNA	EUR 154

ATP5J2-PTCD1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2749003	ABM	1.0 ug DNA	EUR 154

ATP5J2-PTCD1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2749004	ABM	1.0 ug DNA	EUR 154

ATP5J2-PTCD1 Protein Vector (Human) (pPB-C-His)
PV063905	ABM	500 ng	Ask for price

ATP5J2-PTCD1 Protein Vector (Human) (pPB-N-His)
PV063906	ABM	500 ng	Ask for price

ATP5J2-PTCD1 Protein Vector (Human) (pPM-C-HA)
PV063907	ABM	500 ng	Ask for price

ATP5J2-PTCD1 Protein Vector (Human) (pPM-C-His)
PV063908	ABM	500 ng	Ask for price

ATP5J2-PTCD1 Protein Vector (Human) (pPB-His-MBP)
PV325262	ABM	500 ng	Ask for price

ATP5J2-PTCD1 Protein Vector (Human) (pPB-His-GST)
PV325263	ABM	500 ng	Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATP5J2 Rabbit Polyclonal Antibody