Arnt 2 Rabbit Polyclonal Antibody

Arnt 2 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

Arnt 2 Polyclonal Antibody
ABP57126-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the N-terminal region of human Arnt 2 at AA range: 40-120 Applications tips:
Description: A polyclonal antibody for detection of Arnt 2 from Human, Mouse, Rat. This Arnt 2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Arnt 2 at AA range: 40-120

Arnt 2 Polyclonal Antibody
ABP57126-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the N-terminal region of human Arnt 2 at AA range: 40-120 Applications tips:
Description: A polyclonal antibody for detection of Arnt 2 from Human, Mouse, Rat. This Arnt 2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human Arnt 2 at AA range: 40-120

Anti-Arnt 2 antibody
STJ91699	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Arnt 2.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
DLR-ARNT-Hu-48T	DL Develop	48T	EUR 517
Should the Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
DLR-ARNT-Hu-96T	DL Develop	96T	EUR 673
Should the Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
DLR-ARNT-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates or other biological fluids.

Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
DLR-ARNT-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) in samples from tissue homogenates or other biological fluids.

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RD-ARNT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RD-ARNT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RD-ARNT-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RD-ARNT-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RDR-ARNT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RDR-ARNT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RDR-ARNT-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT) ELISA Kit
RDR-ARNT-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

HIF1B/ARNT Rabbit pAb
A0972-100ul	Abclonal	100 ul	EUR 308

HIF1B/ARNT Rabbit pAb
A0972-200ul	Abclonal	200 ul	EUR 459

HIF1B/ARNT Rabbit pAb
A0972-20ul	Abclonal	20 ul	EUR 183

HIF1B/ARNT Rabbit pAb
A0972-50ul	Abclonal	50 ul	EUR 223

HIF1B/ARNT Rabbit mAb
A19532-100ul	Abclonal	100 ul	EUR 410

HIF1B/ARNT Rabbit mAb
A19532-200ul	Abclonal	200 ul	EUR 571

HIF1B/ARNT Rabbit mAb
A19532-20ul	Abclonal	20 ul	EUR 221

HIF1B/ARNT Rabbit mAb
A19532-50ul	Abclonal	50 ul	EUR 287

HIF1B/ARNT Rabbit pAb
A16990-100ul	Abclonal	100 ul	EUR 308

HIF1B/ARNT Rabbit pAb
A16990-200ul	Abclonal	200 ul	EUR 459

HIF1B/ARNT Rabbit pAb
A16990-20ul	Abclonal	20 ul	EUR 183

HIF1B/ARNT Rabbit pAb
A16990-50ul	Abclonal	50 ul	EUR 223

HIF1B/ARNT Rabbit pAb
A14705-100ul	Abclonal	100 ul	EUR 308

HIF1B/ARNT Rabbit pAb
A14705-200ul	Abclonal	200 ul	EUR 459

HIF1B/ARNT Rabbit pAb
A14705-20ul	Abclonal	20 ul	EUR 183

HIF1B/ARNT Rabbit pAb
A14705-50ul	Abclonal	50 ul	EUR 223

HIF-1 ?/ARNT Polyclonal Antibody
EA159-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HIF-1 ?/ARNT from Rat/ Mouse/ Human. This antibody is tested and validated for WB, ELISA, IHC

HIF-1 ?/ARNT Polyclonal Antibody
EA159-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HIF-1 ?/ARNT from Rat/ Mouse/ Human. This antibody is tested and validated for WB, ELISA, IHC

HIF-1?/ARNT Polyclonal Antibody
EA167-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HIF-1?/ARNT from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC

HIF-1?/ARNT Polyclonal Antibody
EA167-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HIF-1?/ARNT from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC

ARNT antibody
70R-21450	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ARNT antibody

Arnt antibody
70R-7856	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Arnt antibody

Arnt antibody
70R-7857	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Arnt antibody

ARNT antibody
70R-31659	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal ARNT antibody

ARNT Antibody
ABD3136	Lifescience Market	100 ug	EUR 438

ARNT Antibody
ABD6154	Lifescience Market	100 ug	EUR 438

ARNT Antibody
33731-100ul	SAB	100ul	EUR 252

ARNT Antibody
33731-50ul	SAB	50ul	EUR 187

ARNT Antibody
32101-100ul	SAB	100ul	EUR 252

ARNT antibody
10R-3373	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal ARNT antibody

ARNT antibody
10R-3374	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal ARNT antibody

ARNT antibody
10R-3377	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal ARNT antibody

ARNT Antibody
DF6154	Affbiotech	200ul	EUR 304
Description: ARNT Antibody detects endogenous levels of total ARNT.

ARNT Antibody
DF3136	Affbiotech	200ul	EUR 304
Description: ARNT Antibody detects endogenous levels of total ARNT.

ARNT Antibody
1-CSB-PA002121GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ARNT Antibody
1-CSB-PA002907	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

ARNT Antibody
CSB-PA174700-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

ARNT Antibody
CSB-PA174700-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

ARNT Antibody
1-CSB-PA080154	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against ARNT. Recognizes ARNT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500

Rabbit Polyclonal Antibody to Human Topoisomerase I (Rabbit Serum)
TG2012-2	TopoGen	250 ul	EUR 380

Anti-Bcl-2 Rabbit Monoclonal Antibody
M00040-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Bcl-2 Antibody. Validated in IF, WB and tested in Human, Mouse.

ARNT Conjugated Antibody
C32101	SAB	100ul	EUR 397

ARNT,HIF1B Antibody
abx230594-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Anti-ARNT antibody
STJ22685	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants.

Anti-ARNT antibody
STJ116905	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants.

Arnt/ Rat Arnt ELISA Kit
ELI-07321r	Lifescience Market	96 Tests	EUR 886

Polyclonal ARNT (aa558-570) Antibody (internal region)
APG01987G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ARNT (aa558-570) (internal region). This antibody is tested and proven to work in the following applications:

Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348
M00084-2	BosterBio	100uL	EUR 397
Description: Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348 tested in WB, IHC, reactive to Human

ARNT siRNA
20-abx900450	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ARNT siRNA
20-abx908189	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ARNT siRNA
20-abx908190	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-ARNT
YF-PA10337	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to ARNT

anti- ARNT,HIF1B antibody
FNab00594	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IP: 1:500-1:2000 Immunogen: aryl hydrocarbon receptor nuclear translocator Uniprot ID: P27540 Gene ID: 405 Research Area: Epigenetics, Cardiovascular, Metabolism, Signal Transduction
Description: Antibody raised against ARNT,HIF1B

Anti-ARNT,HIF1B antibody
PAab00594	Lifescience Market	100 ug	EUR 386

Anti-HIF1B/ARNT antibody
STJ119290	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]

Polyclonal ARNT / HIF-1-Beta Antibody (aa528-544)
APG01989G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ARNT / HIF-1-Beta (aa528-544). This antibody is tested and proven to work in the following applications:

Aryl hydrocarbon receptor nuclear translocator (ARNT) polyclonal antibody
ABP-PAB-10487	Allele Biotech	100 ug	Ask for price
Product line: Genetic Disease Markers Brand:

Rabbit Anti-Human ARNT monoclonal antibody, clone TU16-36
CABT-L680	Creative Diagnostics	100 ul	EUR 777

HIF-1 ?/ARNT Monoclonal Antibody
EM1242-100ul	ELK Biotech	100ul	EUR 279
Description: A Mouse Monoclonal antibody against HIF-1 ?/ARNT from Mouse. This antibody is tested and validated for WB, ELISA, IHC

HIF-1 ?/ARNT Monoclonal Antibody
EM1242-50ul	ELK Biotech	50ul	EUR 207
Description: A Mouse Monoclonal antibody against HIF-1 ?/ARNT from Mouse. This antibody is tested and validated for WB, ELISA, IHC

Anti-HIF1 beta/ARNT Antibody
PB9129	BosterBio	100ug/vial	EUR 294

Anti-ARNT (aa558-570) antibody
STJ73329	St John's Laboratory	100 µg	EUR 359

Anti-ARNT (aa69-82) antibody
STJ73330	St John's Laboratory	100 µg	EUR 359

Arnt Blocking Peptide
33R-8649	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Arnt antibody, catalog no. 70R-7857

ARNT Blocking Peptide
DF6154-BP	Affbiotech	1mg	EUR 195

ARNT Blocking Peptide
DF3136-BP	Affbiotech	1mg	EUR 195

ARNT cloning plasmid
CSB-CL002121HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1251 Sequence: atggcggcgactactgccaaccccgaaatgacatcagatgtaccatcactgggtccagccattgcctctggaaactctggacctggaattcaaggtggaggagccattgtccagagggctattaagcggcgaccagggctggattttgatgatgatggagaagggaacagtaaat Show more
Description: A cloning plasmid for the ARNT gene.

Anti-ARNT (1F12)
YF-MA12005	Abfrontier	50 ug	EUR 363
Description: Mouse monoclonal to ARNT

Anti-ARNT (1F12)
YF-MA12006	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to ARNT

Anti-ARNT (3D10)
YF-MA10060	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ARNT

Anti-p53 Rabbit Monoclonal Antibody
M00001-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal p53 Antibody. Validated in ICC/IF, WB and tested in Human.

Anti-PTEN Rabbit Monoclonal Antibody
M00006-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal PTEN Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-STAT3 Rabbit Monoclonal Antibody
M00007-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal STAT3 Antibody. Validated in IP, IF, WB and tested in Human.

Anti-Rb Rabbit Monoclonal Antibody
M00039-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Rb Antibody. Validated in IP, IF, WB and tested in Human, Mouse.

Anti-Ras Rabbit Monoclonal Antibody
M00099-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Ras Antibody. Validated in Flow Cytometry, IP, WB and tested in Human, Mouse, Rat.

Anti-ERK1 Rabbit Monoclonal Antibody
M00104-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal ERK1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-p21 Rabbit Monoclonal Antibody
M00145-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal p21 Antibody. Validated in IF, ICC, WB and tested in Human, Mouse, Rat.

Anti-p38 Rabbit Monoclonal Antibody
M00176-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal p38 Antibody. Validated in ChIP, IP, IF, WB and tested in Human, Mouse, Rat.

Anti-Rho Rabbit Monoclonal Antibody
M00207-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Rho Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-GFAP Rabbit Monoclonal Antibody
M00213-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal GFAP Antibody. Validated in IF, IHC, WB and tested in Human, Rat.

Anti-LRRK2 Rabbit Monoclonal Antibody
M00221-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal LRRK2 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-MiTF Rabbit Monoclonal Antibody
M00269-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal MiTF Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PAX6 Rabbit Monoclonal Antibody
M00273-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal PAX6 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-MEK1 Rabbit Monoclonal Antibody
M00292-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal MEK1 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Anti-Survivin Rabbit Monoclonal Antibody
M00379-2	BosterBio	100ug/vial	EUR 397
Description: Anti-Survivin Rabbit Monoclonal Antibody tested for IP, IHC, WB in Mouse, Rat

Anti-Hsp27 Rabbit Monoclonal Antibody
M00676-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Hsp27 Antibody. Validated in Flow Cytometry and tested in Human, Mouse, Rat.

Anti-SOX10 Rabbit Monoclonal Antibody
M00758-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal SOX10 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-PAX8 Rabbit Monoclonal Antibody
M00943-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal PAX8 Antibody. Validated in IF, WB and tested in Human.

Anti-PGP9.5 Rabbit Monoclonal Antibody
M01018-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal PGP9.5 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Anti-Podoplanin Rabbit Monoclonal Antibody
M01124-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Podoplanin Antibody. Validated in WB and tested in Human.

Anti-CD74 Rabbit Monoclonal Antibody
M01340-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal CD74 Antibody. Validated in IF, WB and tested in Human.

Anti-CD31 Rabbit Monoclonal Antibody
M01513-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal CD31 Antibody. Validated in WB and tested in Human.

Anti-Actin Rabbit Monoclonal Antibody
M02014-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Actin Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

Anti-MBP Rabbit Monoclonal Antibody
M30934-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal MBP Antibody. Validated in WB and tested in All species.

Anti-GFP Rabbit Monoclonal Antibody
M30939-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal GFP Antibody. Validated in IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

Rabbit Aryl hydrocarbon receptor nuclear translocator, ARNT ELIS
ELI-07322Ra	Lifescience Market	96 Tests	EUR 928

ARNT sgRNA CRISPR Lentivector (Human) (Target 2)
K0125503	ABM	1.0 ug DNA	EUR 154

Arnt sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3968803	ABM	1.0 ug DNA	EUR 154

Arnt sgRNA CRISPR Lentivector (Rat) (Target 2)
K6870003	ABM	1.0 ug DNA	EUR 154

Cyclooxygenase 2 Rabbit Polyclonal Antibody
38024-100ul	SAB	100ul	EUR 252

Cyclooxygenase 2 Rabbit Polyclonal Antibody
38024-50ul	SAB	50ul	EUR 187

IGFBP-2 Polyclonal Antibody (Rabbit)
PAAI1	GroPep	200 µg	EUR 299

Anti-Caspase-8 Rabbit Monoclonal Antibody
M00042-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Caspase-8 Antibody. Validated in ICC/IF, WB and tested in Human.

Anti-ER alpha Rabbit Monoclonal Antibody
M00057-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal ER alpha Antibody. Validated in ChIP, Flow Cytometry, IF, IHC, ICC, WB and tested in Canine, Human, Mouse, Rat.

Anti-Cleaved PARP Rabbit Monoclonal Antibody
M00122-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Cleaved PARP Antibody. Validated in Flow Cytometry, IP, IF, ICC, WB and tested in Human.

Anti-CDK1/Cdc2 Rabbit Monoclonal Antibody
M00209-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal CDK1/Cdc2 Antibody. Validated in IP, IF, IHC, WB and tested in Human.

Anti-Androgen Receptor Rabbit Monoclonal Antibody
M00542-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Androgen Receptor Antibody. Validated in IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

Anti-Cyclin B1 Rabbit Monoclonal Antibody
M00745-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Cyclin B1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse.

Anti-Liver Arginase Rabbit Monoclonal Antibody
M01106-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Liver Arginase Antibody. Validated in IP, IF, IHC, WB and tested in Human.

Anti-Sumo2/3 Rabbit Monoclonal Antibody
M01282-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Sumo2/3 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-Cytokeratin 18 Rabbit Monoclonal Antibody
M01357-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Cytokeratin 18 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-Cytokeratin 8 Rabbit Monoclonal Antibody
M01421-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Cytokeratin 8 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse.

Anti-Cytokeratin 14 Rabbit Monoclonal Antibody
M01432-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Cytokeratin 14 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-CD8 alpha Rabbit Monoclonal Antibody
M02236-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal CD8 alpha Antibody. Validated in IHC and tested in Human.

Anti-Cytokeratin 7 Rabbit Monoclonal Antibody
M02416-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Cytokeratin 7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-Caspase-6 Rabbit Monoclonal Antibody
M02631-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Caspase-6 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Anti-CD3 epsilon Rabbit Monoclonal Antibody
M02675-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal CD3 epsilon Antibody. Validated in Flow Cytometry, IP, IHC, WB and tested in Human.

Anti-Histone H4 Rabbit Monoclonal Antibody
M14495-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Histone H4 Antibody. Validated in ChIP, IP, IF, WB and tested in Human, Mouse, Rat.

Anti-Histone H2A Rabbit Monoclonal Antibody
M16777-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Histone H2A Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.

Anti-EpCAM/Trop1 Rabbit Monoclonal Antibody
M30950-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal EpCAM/Trop1 Antibody. Validated in WB and tested in Human.

Anti-Cytochrome C Rabbit Monoclonal Antibody
M03529-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Cytochrome C Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Polyclonal ARNT (aa69-82) Antibody (internal region, near N-Term)
APG01988G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ARNT (aa69-82) (internal region, near N-Term). This antibody is tested and proven to work in the following applications:

HIF-1 Beta/ARNT Monoclonal Antibody
ABM40245-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein Applications tips:
Description: A monoclonal antibody for detection of HIF-1 Beta/ARNT from Mouse. This HIF-1 Beta/ARNT antibody is for WB, IHC-P. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

HIF-1 Beta/ARNT Monoclonal Antibody
ABM40245-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein Applications tips:
Description: A monoclonal antibody for detection of HIF-1 Beta/ARNT from Mouse. This HIF-1 Beta/ARNT antibody is for WB, IHC-P. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

HIF-1 Beta/ARNT Monoclonal Antibody
ABM40245-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein Applications tips:
Description: A monoclonal antibody for detection of HIF-1 Beta/ARNT from Mouse. This HIF-1 Beta/ARNT antibody is for WB, IHC-P. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

Arnt 2 Rabbit Polyclonal Antibody