ARHGAP12 Rabbit Polyclonal Antibody

ARHGAP12 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

ARHGAP12 Polyclonal Antibody
ABP57037-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human ARHGAP12 at AA range: 310-390
  • Applications tips:
Description: A polyclonal antibody for detection of ARHGAP12 from Human, Mouse, Rat. This ARHGAP12 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ARHGAP12 at AA range: 310-390
ARHGAP12 Polyclonal Antibody
ABP57037-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ARHGAP12 at AA range: 310-390
  • Applications tips:
Description: A polyclonal antibody for detection of ARHGAP12 from Human, Mouse, Rat. This ARHGAP12 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ARHGAP12 at AA range: 310-390
ARHGAP12 Polyclonal Antibody
ES8036-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ARHGAP12 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ARHGAP12 Polyclonal Antibody
ES8036-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ARHGAP12 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ARHGAP12 Antibody
39930-100ul 100ul
EUR 390
ARHGAP12 Antibody
1-CSB-PA070306
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ARHGAP12. Recognizes ARHGAP12 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000
ARHGAP12 antibody
70R-34960 100 ug
EUR 349
Description: Purified Rabbit polyclonal ARHGAP12 antibody
Anti-ARHGAP12 antibody
STJ91680 200 µl
EUR 197
Description: Rabbit polyclonal to ARHGAP12.
ARHGAP12 siRNA
20-abx907963
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ARHGAP12 siRNA
20-abx907964
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-ARHGAP12
YF-PA21806 50 ug
EUR 363
Description: Mouse polyclonal to ARHGAP12
ARHGAP12 cloning plasmid
CSB-CL816896HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2400
  • Sequence: ATGAAAATGGCTGACAGAAGTGGGAAGATTATTCCAGGACAAGTGTATATTGAGGTGGAATATGATTATGAATATGAAGCAAAGGACAGAAAGATTGTGATAAAACAAGGGGAGAGGTACATCTTGGTGAAAAAGACCAATGATGACTGGTGGCAAGTCAAGCCAGATGAAAACT
  • Show more
Description: A cloning plasmid for the ARHGAP12 gene.
Mouse ARHGAP12 shRNA Plasmid
20-abx978392
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ARHGAP12 shRNA Plasmid
20-abx964256
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rho GTPase Activating Protein 12 (ARHGAP12) Antibody
abx037200-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Rho GTPase Activating Protein 12 (ARHGAP12) Antibody
20-abx327809
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Arhgap12 ORF Vector (Rat) (pORF)
ORF063582 1.0 ug DNA
EUR 506
ARHGAP12 ORF Vector (Human) (pORF)
ORF012235 1.0 ug DNA
EUR 354
Arhgap12 ORF Vector (Mouse) (pORF)
ORF038921 1.0 ug DNA
EUR 506
Arhgap12 ORF Vector (Mouse) (pORF)
ORF038922 1.0 ug DNA
EUR 506
Arhgap12 sgRNA CRISPR Lentivector set (Mouse)
K4939201 3 x 1.0 ug
EUR 339
Arhgap12 sgRNA CRISPR Lentivector set (Rat)
K6599901 3 x 1.0 ug
EUR 339
ARHGAP12 sgRNA CRISPR Lentivector set (Human)
K0115401 3 x 1.0 ug
EUR 339
Arhgap12 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4939202 1.0 ug DNA
EUR 154
Arhgap12 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4939203 1.0 ug DNA
EUR 154
Arhgap12 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4939204 1.0 ug DNA
EUR 154
Arhgap12 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6599902 1.0 ug DNA
EUR 154
Arhgap12 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6599903 1.0 ug DNA
EUR 154
Arhgap12 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6599904 1.0 ug DNA
EUR 154
ARHGAP12 sgRNA CRISPR Lentivector (Human) (Target 1)
K0115402 1.0 ug DNA
EUR 154
ARHGAP12 sgRNA CRISPR Lentivector (Human) (Target 2)
K0115403 1.0 ug DNA
EUR 154
ARHGAP12 sgRNA CRISPR Lentivector (Human) (Target 3)
K0115404 1.0 ug DNA
EUR 154
ARHGAP12 Protein Vector (Mouse) (pPB-C-His)
PV155682 500 ng
EUR 1065
ARHGAP12 Protein Vector (Mouse) (pPB-N-His)
PV155683 500 ng
EUR 1065
ARHGAP12 Protein Vector (Mouse) (pPM-C-HA)
PV155684 500 ng
EUR 1065
ARHGAP12 Protein Vector (Mouse) (pPM-C-His)
PV155685 500 ng
EUR 1065
ARHGAP12 Protein Vector (Mouse) (pPB-C-His)
PV155686 500 ng
EUR 1065
ARHGAP12 Protein Vector (Mouse) (pPB-N-His)
PV155687 500 ng
EUR 1065
ARHGAP12 Protein Vector (Mouse) (pPM-C-HA)
PV155688 500 ng
EUR 1065
ARHGAP12 Protein Vector (Mouse) (pPM-C-His)
PV155689 500 ng
EUR 1065
ARHGAP12 Protein Vector (Rat) (pPB-C-His)
PV254326 500 ng
EUR 603
ARHGAP12 Protein Vector (Rat) (pPB-N-His)
PV254327 500 ng
EUR 603
ARHGAP12 Protein Vector (Rat) (pPM-C-HA)
PV254328 500 ng
EUR 603
ARHGAP12 Protein Vector (Rat) (pPM-C-His)
PV254329 500 ng
EUR 603
ARHGAP12 Protein Vector (Human) (pPB-His-MBP)
PV323254 500 ng
EUR 481
ARHGAP12 Protein Vector (Human) (pPB-His-GST)
PV323255 500 ng
EUR 481
ARHGAP12 Protein Vector (Human) (pPB-C-His)
PV048937 500 ng
EUR 481
ARHGAP12 Protein Vector (Human) (pPB-N-His)
PV048938 500 ng
EUR 481
ARHGAP12 Protein Vector (Human) (pPM-C-HA)
PV048939 500 ng
EUR 481
ARHGAP12 Protein Vector (Human) (pPM-C-His)
PV048940 500 ng
EUR 481
Arhgap12 3'UTR GFP Stable Cell Line
TU152033 1.0 ml Ask for price

ARHGAP12 Rabbit Polyclonal Antibody