ACYP2 Rabbit Polyclonal Antibody

ACYP2 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

ACYP2 Polyclonal Antibody
ABP57101-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human ACYP2 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of ACYP2 from Human, Rat. This ACYP2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ACYP2 at AA range: 40-120
ACYP2 Polyclonal Antibody
ABP57101-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ACYP2 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of ACYP2 from Human, Rat. This ACYP2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ACYP2 at AA range: 40-120
ACYP2 Polyclonal Antibody
ES8100-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ACYP2 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ACYP2 Polyclonal Antibody
ES8100-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ACYP2 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ACYP2 Rabbit pAb
A15636-100ul 100 ul
EUR 308
ACYP2 Rabbit pAb
A15636-200ul 200 ul
EUR 459
ACYP2 Rabbit pAb
A15636-20ul 20 ul
EUR 183
ACYP2 Rabbit pAb
A15636-50ul 50 ul
EUR 223
ACYP2 antibody
70R-15582 50 ul
EUR 435
Description: Rabbit polyclonal ACYP2 antibody
ACYP2 Antibody
45748-100ul 100ul
EUR 252
ACYP2 Antibody
45748-50ul 50ul
EUR 187
ACYP2 Antibody
1-CSB-PA001266GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ACYP2. Recognizes ACYP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
ACYP2 Antibody
1-CSB-PA001266LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACYP2. Recognizes ACYP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
ACYP2 Antibody
1-CSB-PA080064
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ACYP2. Recognizes ACYP2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
ACYP2 Antibody
DF9159 200ul
EUR 304
Description: ACYP2 Antibody detects endogenous levels of total ACYP2.
ACYP2 Antibody
ABD9159 100 ug
EUR 438
ACYP2 Conjugated Antibody
C45748 100ul
EUR 397
anti- ACYP2 antibody
FNab00134 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: acylphosphatase 2, muscle type
  • Uniprot ID: P14621
  • Gene ID: 98
  • Research Area: Metabolism
Description: Antibody raised against ACYP2
Anti-ACYP2 antibody
PAab00134 100 ug
EUR 386
Anti-ACYP2 antibody
STJ118097 100 µl
EUR 277
Anti-ACYP2 antibody
STJ91474 200 µl
EUR 197
Description: Rabbit polyclonal to ACYP2.
Acyp2/ Rat Acyp2 ELISA Kit
ELI-24593r 96 Tests
EUR 886
Acylphosphatase 2, Muscle (ACYP2) Polyclonal Antibody (Human)
4-PAC279Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACYP2 (Ser2~Tyr99)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Acylphosphatase 2, Muscle (ACYP2)
Acylphosphatase 2, Muscle (ACYP2) Polyclonal Antibody (Mouse)
4-PAC279Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACYP2 (Leu2~Tyr106)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Acylphosphatase 2, Muscle (ACYP2)
Rabbit Acylphosphatase 2(ACYP2) ELISA kit
E04A1238-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Acylphosphatase 2(ACYP2) ELISA kit
E04A1238-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Acylphosphatase 2(ACYP2) ELISA kit
E04A1238-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Acylphosphatase- 2, ACYP2 ELISA KIT
ELI-34965Ra 96 Tests
EUR 928
ACYP2 siRNA
20-abx906691
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ACYP2 siRNA
20-abx906692
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-ACYP2
YF-PA23173 50 ul
EUR 334
Description: Mouse polyclonal to ACYP2
ACYP2 Antibody, HRP conjugated
1-CSB-PA001266LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACYP2. Recognizes ACYP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ACYP2 Antibody, FITC conjugated
1-CSB-PA001266LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACYP2. Recognizes ACYP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ACYP2 Antibody, Biotin conjugated
1-CSB-PA001266LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACYP2. Recognizes ACYP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Acylphosphatase 2 (ACYP2) Antibody
abx037999-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Acylphosphatase 2 (ACYP2) Antibody
20-abx147971
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Acylphosphatase 2 (ACYP2) Antibody
20-abx302208
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Acylphosphatase 2 (ACYP2) Antibody
abx230134-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Acylphosphatase 2, Muscle (ACYP2) Polyclonal Antibody (Human), APC
4-PAC279Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACYP2 (Ser2~Tyr99)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Acylphosphatase 2, Muscle (ACYP2). This antibody is labeled with APC.
Acylphosphatase 2, Muscle (ACYP2) Polyclonal Antibody (Human), Biotinylated
4-PAC279Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACYP2 (Ser2~Tyr99)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Acylphosphatase 2, Muscle (ACYP2). This antibody is labeled with Biotin.
Acylphosphatase 2, Muscle (ACYP2) Polyclonal Antibody (Human), Cy3
4-PAC279Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACYP2 (Ser2~Tyr99)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Acylphosphatase 2, Muscle (ACYP2). This antibody is labeled with Cy3.
Acylphosphatase 2, Muscle (ACYP2) Polyclonal Antibody (Human), FITC
4-PAC279Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACYP2 (Ser2~Tyr99)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Acylphosphatase 2, Muscle (ACYP2). This antibody is labeled with FITC.
Acylphosphatase 2, Muscle (ACYP2) Polyclonal Antibody (Human), HRP
4-PAC279Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACYP2 (Ser2~Tyr99)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Acylphosphatase 2, Muscle (ACYP2). This antibody is labeled with HRP.
Acylphosphatase 2, Muscle (ACYP2) Polyclonal Antibody (Human), PE
4-PAC279Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACYP2 (Ser2~Tyr99)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Acylphosphatase 2, Muscle (ACYP2). This antibody is labeled with PE.
Acylphosphatase 2, Muscle (ACYP2) Polyclonal Antibody (Mouse), APC
4-PAC279Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACYP2 (Leu2~Tyr106)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Acylphosphatase 2, Muscle (ACYP2). This antibody is labeled with APC.
Acylphosphatase 2, Muscle (ACYP2) Polyclonal Antibody (Mouse), Biotinylated
4-PAC279Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACYP2 (Leu2~Tyr106)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Acylphosphatase 2, Muscle (ACYP2). This antibody is labeled with Biotin.
Acylphosphatase 2, Muscle (ACYP2) Polyclonal Antibody (Mouse), Cy3
4-PAC279Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACYP2 (Leu2~Tyr106)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Acylphosphatase 2, Muscle (ACYP2). This antibody is labeled with Cy3.
Acylphosphatase 2, Muscle (ACYP2) Polyclonal Antibody (Mouse), FITC
4-PAC279Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACYP2 (Leu2~Tyr106)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Acylphosphatase 2, Muscle (ACYP2). This antibody is labeled with FITC.
Acylphosphatase 2, Muscle (ACYP2) Polyclonal Antibody (Mouse), HRP
4-PAC279Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACYP2 (Leu2~Tyr106)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Acylphosphatase 2, Muscle (ACYP2). This antibody is labeled with HRP.
Acylphosphatase 2, Muscle (ACYP2) Polyclonal Antibody (Mouse), PE
4-PAC279Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACYP2 (Leu2~Tyr106)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Acylphosphatase 2, Muscle (ACYP2). This antibody is labeled with PE.
ACYP2 Blocking Peptide
DF9159-BP 1mg
EUR 195
ACYP2 cloning plasmid
CSB-CL001266HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 300
  • Sequence: atgtctaccgcccagtcactcaaatccgtggactacgaggtgttcggaagagtgcagggtgtttgcttcagaatgtatacagaagatgaagctaggaaaataggagtggttggctgggtgaagaataccagcaaaggcaccgtgacaggccaagtgcaggggccagaagacaaagt
  • Show more
Description: A cloning plasmid for the ACYP2 gene.
pCMV-SPORT6-ACYP2
PVT13537 2 ug
EUR 391
Anti-ACYP2 (2H7)
YF-MA11830 100 ug
EUR 363
Description: Mouse monoclonal to ACYP2
Acylphosphatase 2, Muscle (ACYP2) Antibody
20-abx110817
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Acylphosphatase 2, Muscle (ACYP2) Antibody
20-abx130601
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Acylphosphatase 2, Muscle (ACYP2) Antibody
20-abx130602
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Acylphosphatase 2 (ACYP2) Antibody (HRP)
20-abx315186
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Acylphosphatase 2 (ACYP2) Antibody (FITC)
20-abx315187
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Acylphosphatase 2 (ACYP2) Antibody (Biotin)
20-abx315188
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Acylphosphatase 2, Muscle (ACYP2) Antibody
20-abx330125
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Acylphosphatase 2, Muscle (ACYP2) Polyclonal Antibody (Human), APC-Cy7
4-PAC279Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACYP2 (Ser2~Tyr99)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Acylphosphatase 2, Muscle (ACYP2). This antibody is labeled with APC-Cy7.
Acylphosphatase 2, Muscle (ACYP2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC279Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACYP2 (Leu2~Tyr106)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Acylphosphatase 2, Muscle (ACYP2). This antibody is labeled with APC-Cy7.
ACYP2 ELISA KIT|Human
EF007606 96 Tests
EUR 689
Mouse ACYP2 shRNA Plasmid
20-abx978433
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ACYP2 shRNA Plasmid
20-abx950063
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ACYP2 Recombinant Protein (Human)
RP000475 100 ug Ask for price
ACYP2 Recombinant Protein (Mouse)
RP114146 100 ug Ask for price
ACYP2 Recombinant Protein (Rat)
RP189113 100 ug Ask for price
Monoclonal ACYP2 Antibody (monoclonal) (M06), Clone: 2H7
APG01542G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ACYP2 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 2H7. This antibody is applicable in WB, E
Acyp2 ORF Vector (Rat) (pORF)
ORF063039 1.0 ug DNA
EUR 506
ACYP2 ORF Vector (Human) (pORF)
ORF000159 1.0 ug DNA
EUR 95
Acyp2 ORF Vector (Mouse) (pORF)
ORF038050 1.0 ug DNA
EUR 506
Recombinant Acylphosphatase 2, Muscle (ACYP2)
4-RPC279Hu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P14621
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Acylphosphatase 2, Muscle expressed in: E.coli
Recombinant Acylphosphatase 2, Muscle (ACYP2)
4-RPC279Mu01
  • EUR 395.68
  • EUR 209.00
  • EUR 1208.80
  • EUR 469.60
  • EUR 839.20
  • EUR 328.00
  • EUR 2872.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P56375
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Acylphosphatase 2, Muscle expressed in: E.coli
Rat Acylphosphatase 2(ACYP2) ELISA kit
E02A1238-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Acylphosphatase 2(ACYP2) ELISA kit
E02A1238-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Acylphosphatase 2(ACYP2) ELISA kit
E02A1238-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Acylphosphatase 2(ACYP2) ELISA kit
E06A1238-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Acylphosphatase 2(ACYP2) ELISA kit
E06A1238-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Acylphosphatase 2(ACYP2) ELISA kit
E06A1238-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Acylphosphatase 2(ACYP2) ELISA kit
E03A1238-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Acylphosphatase 2(ACYP2) ELISA kit
E03A1238-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Acylphosphatase 2(ACYP2) ELISA kit
E03A1238-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Acylphosphatase 2(ACYP2) ELISA kit
E01A1238-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Acylphosphatase 2(ACYP2) ELISA kit
E01A1238-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Acylphosphatase 2(ACYP2) ELISA kit
E01A1238-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Acylphosphatase 2, Muscle (ACYP2) Protein
20-abx168873
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Acylphosphatase 2, Muscle (ACYP2) Protein
20-abx168874
  • EUR 565.00
  • EUR 258.00
  • EUR 1636.00
  • EUR 662.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Dog Acylphosphatase 2(ACYP2) ELISA kit
E08A1238-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Acylphosphatase 2(ACYP2) ELISA kit
E08A1238-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Acylphosphatase 2(ACYP2) ELISA kit
E08A1238-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Acylphosphatase 2(ACYP2) ELISA kit
E09A1238-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Acylphosphatase 2(ACYP2) ELISA kit
E09A1238-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Acylphosphatase 2(ACYP2) ELISA kit
E09A1238-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Acylphosphatase 2(ACYP2) ELISA kit
E07A1238-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Acylphosphatase 2(ACYP2) ELISA kit
E07A1238-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Acylphosphatase 2(ACYP2) ELISA kit
E07A1238-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Bovine Acylphosphatase- 2, ACYP2 ELISA KIT
ELI-11803b 96 Tests
EUR 928
Porcine Acylphosphatase- 2, ACYP2 ELISA KIT
ELI-12180p 96 Tests
EUR 928
Mouse Acylphosphatase- 2, Acyp2 ELISA KIT
ELI-24580m 96 Tests
EUR 865
Human Acylphosphatase 2 (ACYP2) ELISA Kit
20-abx385614
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Human Acylphosphatase- 2, ACYP2 ELISA KIT
ELI-34853h 96 Tests
EUR 824
Chicken Acylphosphatase- 2, ACYP2 ELISA KIT
ELI-49649c 96 Tests
EUR 928
Acyp2 sgRNA CRISPR Lentivector set (Rat)
K6522001 3 x 1.0 ug
EUR 339
ACYP2 sgRNA CRISPR Lentivector set (Human)
K0040301 3 x 1.0 ug
EUR 339
Acyp2 sgRNA CRISPR Lentivector set (Mouse)
K3742101 3 x 1.0 ug
EUR 339
Guinea pig Acylphosphatase 2(ACYP2) ELISA kit
E05A1238-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Acylphosphatase 2(ACYP2) ELISA kit
E05A1238-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Acylphosphatase 2(ACYP2) ELISA kit
E05A1238-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Acylphosphatase 2(ACYP2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Acyp2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6522002 1.0 ug DNA
EUR 154
Acyp2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6522003 1.0 ug DNA
EUR 154
Acyp2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6522004 1.0 ug DNA
EUR 154
ACYP2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0040302 1.0 ug DNA
EUR 154
ACYP2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0040303 1.0 ug DNA
EUR 154

ACYP2 Rabbit Polyclonal Antibody