ACSS1 Rabbit Polyclonal Antibody

ACSS1 Rabbit Polyclonal Antibody

To Order Now: info@attr-meeting.com

ACSS1 Polyclonal Antibody
ES1588-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ACSS1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
ACSS1 Polyclonal Antibody
ES8528-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ACSS1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ACSS1 Polyclonal Antibody
ES8528-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ACSS1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ACSS1 Polyclonal Antibody
ABP57535-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic peptide from human protein at AA range: 620-689
  • Applications tips:
Description: A polyclonal antibody for detection of ACSS1 from Human, Mouse, Rat. This ACSS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 620-689
ACSS1 Polyclonal Antibody
ABP57535-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 620-689
  • Applications tips:
Description: A polyclonal antibody for detection of ACSS1 from Human, Mouse, Rat. This ACSS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 620-689
ACSS1 Polyclonal Antibody
ABP57535-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 620-689
  • Applications tips:
Description: A polyclonal antibody for detection of ACSS1 from Human, Mouse, Rat. This ACSS1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 620-689
ACSS1 Polyclonal Antibody
ABP50589-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ACSS1 at AA range: 580-660
  • Applications tips:
Description: A polyclonal antibody for detection of ACSS1 from Human, Mouse. This ACSS1 antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ACSS1 at AA range: 580-660
ACSS1 Polyclonal Antibody
ABP50589-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ACSS1 at AA range: 580-660
  • Applications tips:
Description: A polyclonal antibody for detection of ACSS1 from Human, Mouse. This ACSS1 antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ACSS1 at AA range: 580-660
ACSS1 Polyclonal Antibody
ABP50589-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ACSS1 at AA range: 580-660
  • Applications tips:
Description: A polyclonal antibody for detection of ACSS1 from Human, Mouse. This ACSS1 antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ACSS1 at AA range: 580-660
ACSS1 Polyclonal Antibody
28801-100ul 100ul
EUR 252
ACSS1 Polyclonal Antibody
28801-50ul 50ul
EUR 187
ACSS1 Rabbit pAb
A15007-100ul 100 ul
EUR 308
ACSS1 Rabbit pAb
A15007-200ul 200 ul
EUR 459
ACSS1 Rabbit pAb
A15007-20ul 20 ul
EUR 183
ACSS1 Rabbit pAb
A15007-50ul 50 ul
EUR 223
ACSS1 Polyclonal Conjugated Antibody
C28801 100ul
EUR 397
ACSS1 Antibody
ABD13007 100 ug
EUR 438
ACSS1 Antibody
ABD3727 100 ug
EUR 438
ACSS1 antibody
70R-15558 50 ul
EUR 435
Description: Rabbit polyclonal ACSS1 antibody
ACSS1 Antibody
1-CSB-PA925276
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against ACSS1. Recognizes ACSS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000
ACSS1 Antibody
DF3727 200ul
EUR 304
Description: ACSS1 Antibody detects endogenous levels of total ACSS1.
ACSS1 Antibody
1-CSB-PA000808
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ACSS1. Recognizes ACSS1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000
ACSS1 Antibody
1-CSB-PA001202GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ACSS1. Recognizes ACSS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
ACSS1 (Acetyl-K642) Polyclonal Antibody
HW182-100ul 100ul
EUR 252
ACSS1 (Acetyl-K642) Polyclonal Antibody
HW182-50ul 50ul
EUR 187
ACSS1 (Acetyl-K642) Polyclonal Antibody
ES8818-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ACSS1 (Acetyl-K642) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ACSS1 (Acetyl-K642) Polyclonal Antibody
ES8818-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ACSS1 (Acetyl-K642) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ACSS1 (Acetyl-K642) Polyclonal Antibody
ABP57695-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ACSS1 (Acetyl-K642) protein at amino acid sequence of K642
  • Applications tips:
Description: A polyclonal antibody for detection of ACSS1 Acetyl-K642) from Human, Mouse, Rat. This ACSS1 Acetyl-K642) antibody is for WB, ICC. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACSS1 (Acetyl-K642) protein at amino acid sequence of K642
ACSS1 (Acetyl-K642) Polyclonal Antibody
ABP57695-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ACSS1 (Acetyl-K642) protein at amino acid sequence of K642
  • Applications tips:
Description: A polyclonal antibody for detection of ACSS1 Acetyl-K642) from Human, Mouse, Rat. This ACSS1 Acetyl-K642) antibody is for WB, ICC. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACSS1 (Acetyl-K642) protein at amino acid sequence of K642
ACSS1 (Acetyl-K642) Polyclonal Antibody
ABP57695-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ACSS1 (Acetyl-K642) protein at amino acid sequence of K642
  • Applications tips:
Description: A polyclonal antibody for detection of ACSS1 Acetyl-K642) from Human, Mouse, Rat. This ACSS1 Acetyl-K642) antibody is for WB, ICC. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACSS1 (Acetyl-K642) protein at amino acid sequence of K642
anti- ACSS1 antibody
FNab00113 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:10000
  • IP: 1:200-1:2000
  • Immunogen: acyl-CoA synthetase short-chain family member 1
  • Uniprot ID: Q9NUB1
  • Gene ID: 84532
  • Research Area: Metabolism
Description: Antibody raised against ACSS1
Anti-ACSS1 Antibody
A07972 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ACSS1 Antibody (ACSS1) detection.tested for WB in Human, Mouse.
Anti-ACSS1 antibody
PAab00113 100 ug
EUR 386
Anti-ACSS1 antibody
STJ91458 200 µl
EUR 197
Description: Rabbit polyclonal to ACSS1.
Anti-ACSS1 antibody
STJ98641 200 µl
EUR 197
Description: Rabbit polyclonal to ACSS1.
Anti-ACSS1 antibody
STJ117203 100 µl
EUR 277
Description: This gene encodes a mitochondrial acetyl-CoA synthetase enzyme. A similar protein in mice plays an important role in the tricarboxylic acid cycle by catalyzing the conversion of acetate to acetyl CoA. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.
ACSS1 siRNA
20-abx906607
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ACSS1 siRNA
20-abx906608
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-ACSS1
YF-PA21425 50 ug
EUR 363
Description: Mouse polyclonal to ACSS1
Acetyl-ACSS1 (K642) Antibody
1-CSB-PA848164
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-ACSS1 (K642). Recognizes Acetyl-ACSS1 (K642) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000
ACSS1 Blocking Peptide
20-abx061084
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
ACSS1 cloning plasmid
CSB-CL882105HU-10ug 10ug
EUR 689
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2070
  • Sequence: atggcggcgcgcaccctgggccgcggcgtcgggaggctgctgggcagcctgcgagggctctcggggcagcccgcgcggccgccgtgcggggtgagcgcgccgcgcagggcggcctcgggaccctcgggcagcgctcccgcagttgcagcagcagcagcacagccaggctcgtatc
  • Show more
Description: A cloning plasmid for the ACSS1 gene.
ACSS1 Blocking Peptide
DF3727-BP 1mg
EUR 195
Anti-ACSS1 (Acetyl K642) antibody
STJ98836 200 µl
EUR 197
Description: Rabbit polyclonal to E2F-1 (Acetyl-K125).
Mouse ACSS1 shRNA Plasmid
20-abx976721
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ACSS1 shRNA Plasmid
20-abx963513
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ACSS1 ELISA KIT|Human
EF007590 96 Tests
EUR 689
Human ACSS1 ELISA KIT
ELI-34917h 96 Tests
EUR 824
Mouse Acss1 ELISA KIT
ELI-49859m 96 Tests
EUR 865
ACSS1 Recombinant Protein (Human)
RP000343 100 ug Ask for price
ACSS1 Recombinant Protein (Rat)
RP188990 100 ug Ask for price
ACSS1 Recombinant Protein (Mouse)
RP114011 100 ug Ask for price
ACSS1 ORF Vector (Human) (pORF)
ORF000115 1.0 ug DNA
EUR 95
Acss1 ORF Vector (Mouse) (pORF)
ORF038005 1.0 ug DNA
EUR 506
Acss1 ORF Vector (Rat) (pORF)
ORF062998 1.0 ug DNA
EUR 506
Rabbit Acetyl coenzyme A synthetase 2 like, mitochondrial(ACSS1) ELISA kit
E04A1215-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Acetyl coenzyme A synthetase 2 like, mitochondrial(ACSS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Acetyl coenzyme A synthetase 2 like, mitochondrial(ACSS1) ELISA kit
E04A1215-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Acetyl coenzyme A synthetase 2 like, mitochondrial(ACSS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Acetyl coenzyme A synthetase 2 like, mitochondrial(ACSS1) ELISA kit
E04A1215-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Acetyl coenzyme A synthetase 2 like, mitochondrial(ACSS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ACSS1 sgRNA CRISPR Lentivector set (Human)
K0033801 3 x 1.0 ug
EUR 339
Acss1 sgRNA CRISPR Lentivector set (Mouse)
K4013201 3 x 1.0 ug
EUR 339
Acss1 sgRNA CRISPR Lentivector set (Rat)
K6701001 3 x 1.0 ug
EUR 339
Recombinant Human ACSS1, His, Yeast-100ug
QP9911-ye-100ug 100ug
EUR 571
Recombinant Human ACSS1, His, Yeast-10ug
QP9911-ye-10ug 10ug
EUR 272
Recombinant Human ACSS1, His, Yeast-1mg
QP9911-ye-1mg 1mg
EUR 2303
Recombinant Human ACSS1, His, Yeast-200ug
QP9911-ye-200ug 200ug
EUR 898
Recombinant Human ACSS1, His, Yeast-500ug
QP9911-ye-500ug 500ug
EUR 1505
Recombinant Human ACSS1, His, Yeast-50ug
QP9911-ye-50ug 50ug
EUR 354
ACSS1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0033802 1.0 ug DNA
EUR 154
ACSS1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0033803 1.0 ug DNA
EUR 154
ACSS1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0033804 1.0 ug DNA
EUR 154
Acss1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4013202 1.0 ug DNA
EUR 154
Acss1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4013203 1.0 ug DNA
EUR 154
Acss1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4013204 1.0 ug DNA
EUR 154
Acss1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6701002 1.0 ug DNA
EUR 154

ACSS1 Rabbit Polyclonal Antibody